Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
| Isoform | Forward Primer | Reverse Primer |
|---|---|---|
| TPM1 HMW | cagatgctgaagctcgacaa | gcacgatccaactcttcc |
| TPM1 LMW | gggagtagctcgctggag | agctggatgcgtctgttca |
| TPM4 HMW | ctgaggacaagtgcaagcag | gtccaactcctcctcaacga |
| TPM4 LMW | cgagaaagctgaaggtgatg | tcctctctcactctcatctgc |
Primer sequences used for the amplification of TPM1 and TPM4 high and low molecular weight isoforms.
