Improved regeneration and transformation protocols for three strawberry cultivars

Abstract

Strawberry (Fragaria × ananassa) is an economically important soft fruit crop with polyploid genome which makes the breeding of new cultivars difficult. Simple and efficient method for transformation and regeneration is required for cultivars improvement in strawberry. In the present study, adventitious shoot regeneration has been investigated in three cultivated strawberry plants, i.e., Festival, Sweet Charly and Florida via direct organogenesis using the in vitro juvenile leaves as explants. Explants were collected after sub-culturing on a propagation medium composed of MS supplemented with 0.5 mg/l BA; 0.1 mg/l GA3 and 0.1 mg/l IBA. To select the suitable organogenesis, the explants of the three cultivars were cultured on MS medium supplemented with different concentrations of TDZ (1, 2, 3, and 4 mg/l), then incubated at a temperature of 22 °C ± 2. Medium containing 2 mg/l TDZ revealed the best regeneration efficiency with the three cultivars (72% for Festival, and 73% for Sweet Charly and Florida). After 4 weeks, the produced shoots were cultured on MS medium with different concentrations of BA and Kin to enhance shoot elongation. Results showed that the medium containing 1.5 mg/l BA and 0.5 mg/l Kin revealed highest elongation efficiency (88% and 94%) for Festival and Sweet Charly, respectively. On the other hand, medium containing 1.5 mg/l BA and 0.1 mg/l Kin showed highest elongation efficiency (90%) in Florida. Elongated shoots were successfully rooted on MS medium containing 1.5 mg/l NAA. Furthermore, transformation of the two cultivars, Festival and Sweet Charly, has been established via Agrobacterium strain LBA44404 containing the plasmid pISV2678 with gus-intron and bar genes. Three days post co-cultivation, GUS activity was screening using the histochemical assay. The results showed 16% and 18% of the tested plant materials has changed into blue color for Festival and Sweet Charly, respectively. Out of 120 explants only 13 shoots were developed on bialaphos medium for each cultivar, representing 10.8% bialaphos resistant strawberry shoot. The presence of the both genes bar and uid A was detected by PCR and Northern giving a transformation efficiency of 5%.

Introduction

The cultivated strawberry (Fragaria × ananassa Duch.), a member of the Rosaceae, is an economically important berry crop with high demand for fresh fruits and processing industry.¹The global strawberry production is nearly 4.1 million metric tons from almost 255 thousand hectare (FAO 2008). Loss in Strawberry production are caused by several factors which involve a complex interaction between a biotic factors (temperature, soil type, and moisture), and pathogenic infections.

The handiness of regeneration system coupled with the ability of infection by Agrobacterium species² makes the strawberry well suited for Agrobacterium-mediated genetic transformation. This allows introducing novel gene(s) with new desired traits in strawberry plants via Agrobacterium mediated strategy.

The application of in vitro technique and genetic engineering could be implemented to overcome the limited potential of strawberry improvement through traditional breeding methods.³An efficient in vitro shoot proliferation and regeneration systems, that used in conjunction with classical breeding methods could accelerate cultivar development programs.^4,5 Several developments of the in vitro techniques are important tools for modern plant improvement programs that introduce new traits into selected plants, clonal multiplication, germplasm improvement and gene conservation of this flavorful and nutritious berry crop, which may develop suitable cultivars in the minimum time.^6,7 Plant regeneration is a crucial aspect of plant biotechnology and tissue culture techniques that facilitates the production of genetically engineered plants, somaclonal variants, and the rapid multiplication of difficult-to-propagate species.^5,7

Establishment of an efficient regeneration system for each strawberry cultivar is an essential pre-requisite for the successful development of transgenic plants. Adventitious buds and shoots regeneration has been previously reported from different explants such as: leaves,^8-16 petioles,^{11,12,15,17,18} peduncles/peduncular base of the flower buds,^17,18 stems,¹⁹ stipules,^11,20 stolon,¹⁸ roots,^11,20 runners⁹and anther cultures.²¹ Furthermore, shoot regeneration was produced directly from field,¹⁰ greenhouse-grown strawberry plants^12,15,22 or from in vitro-grown shoots.^1,11

Transformation in strawberries has been previously documented using different constructs in various genotypes.^23-27 Strawberry genetic transformation has done outstanding progress. The transformation of Fragaria was focused on establishing the system and using genes with potential for pest and herbicide resistance, cold tolerance and ripening.^22,28-36 The aim of this study was to develop an efficient and reproducible Agrobacterium-mediated protocol for the strawberry cultivars using the juvenile leaf explants.

Results and Discussion

Optimization of strawberry regeneration

Plant regeneration from adventitious strawberry explants are accomplished through: (1) formation of viable adventitious shoots from the explant; (2) elongation of the shoots; (3) rooting of the shoots to form whole plants.

Adventitious shoots formation

Pieces from fully juvenile leaves and petioles of 3–4 wk-old from in vitro cultures were used as explants. It was reported that the explants taken from field-grown plants are difficult to sterilize in order to establish in vitro cultures due to high degree of contamination. Thus, it is usually recommended to take explants from plants grown under controlled conditions such as growth room, greenhouse, or from buds which flush from dormant shoots stored indoors.^7,37

To evaluate the best media for the shoot formation, the juvenile leaf explants of the three cultivars (Festival, Sweet Charly and Florida) were cultured on MS medium with TDZ at concentration of 1, 2, and 3 mg/l, individually. Cultures were incubated at dark for a week, then, transferred to light for at least three weeks. It was observed that shoots started to develop 10 d post culturing. Four weeks later the produced shoots were ready for transferring into the elongation medium. Medium containing 2 mg/l TDZ produced the highest regeneration efficiency among the three cultivars. Sweet Charly recorded the highest percentage of regeneration response among the three cultivars (73.3%) followed by 71.6% for Festival and Florida (Table 1; Figure 1). In addition, juvenile leaves of Sweet Charly reached the highest number of shoots per explant (4 shoots /explant) compared with other cultivars under study. These results are in consensus with previous reports^38,38 indicating that chemical composition of the media is one of the factors determining the success of in vitro. In addition, selection of the proper hormones is the key of regeneration success in strawberry.^40-43

Table1. Effect of different TDZ concentration on adventitious shoot regeneration development of the three strawberry cultivars (Festival, Sweet Charly, and Florida).

TDZ Concentration (mg/L)	Total number of explants	Festival	Sweet Charly	Florida
		% of shoots
1	R1 = 100	13	20	10
	R2 = 100	12	19	13
	R3 = 100	11	19	15
	Mean: 100	12	19.3	12.7
2	R1 = 100	72	74	70
	R2 = 100	71	73	72
	R3 = 100	72	73	73
	Mean: 100	71.6	73.3	71.6
3	R1 = 100	39	48	25
	R2 = 100	38	45	23
	R3 = 100	37	45	22
	Mean: 100	38	46	23.3

Figure 1. Direct shoots regeneration from the juvenile leaf explants after, (A) 10 d, (B) 3weeks and, (C) 4 wk.

Organogenesis relies on the inherent plasticity of plant tissues and is regulated by altering the components of the medium. It is well known that to induce shoot formation we need to increase the cytokinin to auxin ratio of the culture medium. Thidiazuron (TDZ), as a substituted to phenylurea (Nphenyl- N'-1,2,3-thidiazol-5-ylurea) was used with its cytokinin- and auxin-like effects, is now among the most active cytokinin-like substances for plant tissue culture and has been used to induce shoot organogenesis of strawberries.¹² Either TDZ alone¹² or in combination with 2,4-dichlorophenoxy-acetic acid (2,4-D)¹¹ or (indol-butyric acid) IBA¹⁴ were found to be effective in strawberry shoot regeneration when leaves are the explants.

Incubation in dark is well- known⁴⁴ to solve the problem of the browning of the surface of plant tissues of in vitro cultured strawberry explants. Browning is produced from the oxidation of phenolic compounds that produce the quinones which reacts with plant tissues leading to tissue poisonous. Therefore, dark incubation is recommended for reducing the tissue browning by inhibiting enzymatic activity that responsible for tissue oxidation.^45,46 In strawberry, dark incubation of leaf explants for at least a week is required to enhance organogenesis in strawberry explants.^{9,20,22,49-51}

Elongation of the shoots

After shoot development, produced shoots in cluster were transferred to different elongated media and incubated for 4 wks. The most efficient elongation medium was selected upon reaching shoots height to approximately 1 cm. Results showed that medium SE6 containing 1.5 mg/l 6-benzyladenine (BA) and 0.5 mg/l kinetin (Kin) was the best for elongated shoots in both Festival and Sweet Charly, while SE5 containing 1.5 mg/l BA and 0.1 mg/l Kin showed the best elongation in Florida. (Table 2; Fig. 2). It was known that cytokinins including BA and kinetin play an integral role in controlling the adventitious shoot formation, promote cell division and leaf cell enlargement that stimulate of leaf expansion. Our result indicates that the BA with a concentration of 1.5 mg/l combined with low concentration of kin (0.1 and 0.5 mg/l) have a positive impact in elongation and proliferation of strawberry plants. It was previously reported that the BA was comparatively more effective than Kin in proliferation of shoots. Similarly, Debnath,⁵² and Haddaidi et al.,⁵³ reported that high concentration of cytokinin with no or law auxin concentration promotes the branching of lateral buds from leaf axis. On other hand, in contrary to our result, Biswas et al.,⁵⁴ recorded that low concentration (0.1 mg/l) of BA is more effective for mass propagation in the studied strawberries. Debnath¹⁵reported that the success in shoots proliferation and roots development was observed when explants were cultured in medium supplemented with zeatin in cultivar Bounty

Table 2. Effect of the different media composition on strawberry shoots elongation.

Media	Festival		Sweet Sherry		Florida
	Elongated shoots	%	Elongated shoots	%	Elongated shoots	%
SE1	24	48	20	40	19	38
SE2	29	58	23	46	25	50
SE3	32	64	31	62	34	68
SE4	35	70	37	74	33	66
SE5	39	78	42	84	45	90
SE6	44	88	47	94	42	84
SE7	36	72	31	62	33	66
SE8	25	50	27	54	23	46

Figure 2. Elongation stage at (A) zero incubation time, (B) one week, (C) 3 wk and (D) 4 wk

Rooting stage of the produced shoots

In order to study root formation, the elongated shoots were transferred to different rooting media. Roots started to appear after about 10 d and complete formation during one month. It was shown that the in vitro-formed roots were thick, possess no hairy roots, grow horizontally. It was observed that the frequency of the rooted shoots number increased when the concentration of IBA and NAA was increased. In addition, the highest concentration of either IBA or NAA which is 1.5 mg/l, revealed the highest percentage of forming roots. Furthermore, IBA revealed higher response than NAA. Among the three cultivars, Festival showed the highest response (Table 3; Fig. 3).

Table 3. The percentage of rooted shoots on different auxins concentrations after 4 wk.

Hormone	Concentration (mg/l)	Festival		Sweet Charly		Florida
		No of rooted shoots	%	No of rooted shoots	%	No of rooted shoots	%
IBA	0.5	18	60	17	56	15	50
	1.0	23	77	22	73	22	37
	1.5	27	90	26	86	24	80
NAA	0.5	13	43	15	50	17	56
	1.0	21	70	17	56	15	50
	1.5	24	80	19	63	21	70

Figure 3. Rooted strawberry shoot before and after incubation for 4 wk on rooting medium

In previous articles, it is recommended using a single step for shoot multiplication and rooting which takes place in the same culture medium.^15,50 Different media composed of MS with or without auxins that have been used for shoot proliferation in strawberry produced roots at the same time.⁵⁵ Auxin free half-strength MS medium⁵⁵ with activated charcoal at concentration of 0.6 g/l and IAA at concentration of 1 mg/l have been also used.⁵⁶ Recent study using IBA proved superior to (1-Naphthaleneacetic acid (NAA) in root formation frequency. Positive effect of IBA in root formation was also reported in case of Centellasiatica⁵⁷ and Acacia sinuate.⁵⁸ On the other hand, Ying et al.⁵⁹ reported that roots was successfully formed at low concentration of NAA (0.02mg/l). Zeatin also is recommended as a suitable hormone for root development.¹⁶

Plant transformation

After optimizing in vitro regeneration of strawberry cultivars, two of them (Sweet Charly and Festival) were subsequently used for establishing Agrobacterium-mediated transformation. Genetic transformation via Agrobacterium with different constructs in various strawberry genotypes has been previously reported.^23-27,60In the present study, Agrobacterium mediated transformation of strawberry plants has been established using the juvenile leaf as explant and the plasmid pISV2678 harbors the gus–intron and bar genes. Transformation in strawberries has been performed in two independent experiments with a total of 120 explants for each cultivar (Sweet Charly and Festival).Explants were soaked O/N Agrobacterium suspension for 5and 10 min; co-cultivated for three days on selected regeneration medium and then transferred onto the selective medium (regeneration medium with 1.5 mg/l bialaphos and 300mg/l carbincillin). It was observed that explants which were immersed in the Agrobacterium culture for 10 min were more efficient for regeneration than 5 min (Data not shown). After about 15 d, a number of 22 out of 120 explants of Festival and 27 out of 120 explants of cultivar Sweet Charly were bialaphos resistant. Six weeks further, the bialaphos resistant explants produced only 13 shoots developed from each cultivar. Shoots were subsequently transferred to the elongation medium with 300 mg/l carbincillin for 4 wk and then transferred to the rooting medium for at least four weeks (Table 4).

Table 4. Transformation efficiency of juvenile leave explants of two strawberry cultivars (Festival and Sweet Charly).

Festival			Sweet Charly
Total No. of explants	No. of survived explants	Produced shoots	Total No. of explants	No. of survived explants	Produced shoots
60	10	5	60	12	7
60	12	8	60	15	6
Total (120)	22	13	Total (120)	27	13
% of survived explants	18.3		% of survived explants	22.5
% of produced shoots	10.8		% of produced shoots	10.8

Rapid shoot regeneration is requested to minimize the risks that are associated with strawberry transformation including escapes, formation of chimeric shoots and somaclonal variation.^7,61In this work, the regeneration period took only 12 to 14 wk, which is less than the previously reported protocols with about 2 wks.⁶⁰

GUS activity screening was performed three days post co-cultivation using the histochemical assay in treated plant leaves. Results showed that 16% and 18% of the tested plant materials stained with blue color for Festival and Sweet Charly, respectively (Fig. 4).

Figure 4. GUS assay of treated leaf explants (left) and control strawberry leaves (right)

The strawberry plants with positive expression of GUS were further confirmed for transgene (bar and gus genes) integration by PCR. The expected 540 bp and 2070 bp bands corresponding to bar and uid A genes, respectively, were detected in six plants out of 13 putatively transgenic shoots (representing 46% transgenic plants) with Festival and Sweet Charly (Fig. 5A1 and 5A2). In order to make clear if there is any relation between the level of expression of gus gene and the level of transcription, Northern hybridization was done with GUS positive plants and transcription level as can be seen from Figure 5B.

Figure 5. (A) PCR analysis of putative transgenic strawberry plants (Lanes 1–13) using, a1) bar-specific primers amplifying 540 bp and a2) gus-specific primers amplifying 2070 bp. (B) northern blot analysis to detect the presence of gus transcription in transformed strawberry plants.

The transformation efficiency was calculated as the number of bialaphos resistant strawberry plants developed on separate shoots with respect to the total number of explants infected, which was 10.8% for both cultivars. However, the transformation efficiency based on the PCR results with respect to a total number of infected explants recorded 5%. Our obtained protocol for strawberry transformation via Agrobacterium is in the same consensus as previously protocols with different cultivars with transformation ratio ranged between 4–11% among different cultivars and transformation protocols. A transformation frequency of 0.95% has been reported for the cultivar ‘Rapella’,⁶² 6.5% for ‘Red Coat’^30,31 and efficiency of 4.22% and 10% with cultivar Chandeler,^22,60and 11% for ‘Firework’.⁶³

Materials and Methods

Plant materials

Strawberry cultivars, Festival, Sweet Charly and Florida were used in this study; these cultivars are kindly provided as in vitro cultures from Agricultural Modern Company (PICO). All cultures were incubated at 22 °C ± 2 °C with a 16 h photoperiod under white fluorescent lamps or at dark in a growth room.

Bacteria and plasmid

The Agrobacterium tumefaciens strain LBA4404 that harboring the plasmid pISV2678 with the gus–intron under the control of 35S promoter and nos terminator as well as the bar fused the AMV Leader gene under the control of nos promoter, pAg7 terminator⁶⁴ was used for optimizing the transformation system in strawberry via Agrobacterium-mediated transformation.⁶⁵ The plasmid was kindly provided by Dr. P. Ratet, Institut des Sciences Vegetales (ISV), Centre National de la Recherche Scientifique (CNRS), Gif-Sur-Yvette, France.

Plant regeneration

Regeneration system of strawberry has been developed using in vitro juvenile leaf as explants. Explants were collected for the three cultivars, i.e., Festival, Sweet Charly, and Florida, from the in vitro cultures on propagation medium which composed of MS basal medium (Murashige and Skoog,⁶⁶ supplemented with 0.5 mg/l BA; 0.1 mg/l gibberelic acid (GA3) and 0.1 mg/l IBA as described by Boxus⁶⁷ and Litwińczuk.⁴²

In order to optimize the proper regeneration medium, the explants were cultured on solid MS medium supplemented with different concentrations (1, 2, 3, and 4 mg/l) of Thidiazuron (TDZ).The cultures were incubated at the growth chamber under dark for one week and then transferred to the light condition. This experiment was repeated three times each time has a number of 100 explants. Data were analyzed based upon the percentage of means.

Subsequently, the produced 4-wk-old shoots in clusters from the previous stage were transferred to the medium for elongating and proliferating. To select the best elongation medium, different concentration and combination of the hormones BA and Kin were tested (Table 5). Data were analyzed based upon the percentage of means.

Table 5. Composition of different elongation media.

Media	Hormone concentration
	BA (mg/l)	Kin (mg/l)
SE1	0.5	0.1
SE2	0.5	0.5
SE3	1.0	0.1
SE4	1.0	0.5
SE5	1.5	0.1
SE6	1.5	0.5
SE7	2.0	0.1
SE8	2.0	0.5

Four weeks further on elongation stage, shoot heights of 1 cm approximately were excised and transferred to different rooting media based on MS basal medium with naphthalene acetic acid (NAA) and IBA in different concentration, 0.5, 0.1, and 1.5 mg/l, individually, and incubated for 3 wk. Each treatment has a total number of 30 shoots. Data were analyzed based upon the percentage of means.

Transformation system of strawberry

Primary culture of Agrobacterium was prepared by inoculating single colony from a freshly streaked plate, in 5 ml of autoclaved liquid YEP medium supplemented with 25 mg/l streptomycin, 10 mg/l rifampicin, 50 mg/l kanamycin. The culture was incubated for overnight in dark at 28 °C. Subculture was performed in a 100 ml YEP medium supplemented with same antibiotics grown under similar conditions. Once the OD₆₀₀ reached 0.8, Agrobacterium cells were pelleted by centrifugation and were resuspended in MS re-suspension medium containing 150 μM acetosyringone to adjust the O.D.600 of the bacterial suspension to ~0.3. In vitro juvenile leaf explants of the two cultivars (Festival and Sweet Charly) were soaked in the Agrobacterium culture for 5, 10 min. This was performed through two replicates and the numbers of explants in each replicate were 60 with a total number of 120 explants. The treated explants were cultured onto selected regeneration medium for 3 d. Subsequently, they were transferred to the selection medium (regeneration medium supplemented with1.5 mg/l bialaphos and 300 mg/L carbinicillin) and incubated for 2–3 wk. Developed shoots were excised from their original explants and then transferred to the root formation medium. Plantlets were then acclimatized in the greenhouse.

Molecular confirmation of putative transgenic plants

Histochemical GUS assay

GUS expression was visually determined using the histochemical assay according to Jefferson et al.⁶⁸ The GUS reaction was performed three day post transformation by incubating the samples with GUS buffer solution containing 1mM X-gluc (5-bromo-4-choloro-3-indolyl-β-glucuronic acid) overnight at 37 °C. The blue color was detected visually by naked eye and using light microscope after bleaching the chlorophyll and fixation in 70% ethanol.

PCR

To confirm the presence of transgenes in bialaphos resistant plants, these plants along with wild type (WT) lines were analyzed through PCR analysis. Total genomic DNA from various independent young leaves of putative transgenic plants was extracted as described by Dellaporta et al.⁶⁹ and was used for PCR using the gus specific primers (forward 5′AACAATGCGCGGTGGTCAGTCCC3′and reverse 5′ATTCATTGTTTGCCTCCCTGCTGC3′)designed to amplify the full gus-intron of 2070bpand the bar specific primers (forward 5′CCACCATGAGCCCAGAACGACG3′and reverse 5′TCAGATCTCGGTGACGG3′)designed to amplify 540 bp. The PCR products were analyzed on 1% agarose gel containing ethidium bromide and visualized under gel documentation unit.

The PCR reactions were performed in a total volume of 25 µl, containing 1 μl DNA, 20 pmol of each primer, 200 μM each dNTP, 0.5 unit Taq DNA polymerase and 3 μl 10x PCR buffer. The PCR temperature profile was as follows: initial denaturation of DNA at 94 °C for 5 min, 35 cycles comprised of 1 min denaturation at 94 °C, 1 min annealing at 55 °C, extension for2 min at 72 °C followed by a final extension step at 72 °C for 7 min. Amplification products were analyzed by electrophoresis on 1% agarose gels and detected by staining with ethidium bromide.

Northern hybridization of transgenic strawberry plants

Total RNA was isolated from various transgenic plants using a modification of a CTAB-based method and was separated with electrophoresis in 1.2% denaturing gel then transferred to Hybond nylon membrane for Northern hybridization.⁷⁰

10.4161/gmcr.27229

Disclosure of Potential Conflicts of Interest

No potential conflicts of interest were disclosed.

Acknowledgments

This work has been funded by Science and Technology Development Fund (STDF) for funding this investigation under a project entitled “Developing strawberry plants resistant to whitefly transmitted geminivirus using siRNA strategy.”