Skip to main content
. 2016 Sep 26;6:32805. doi: 10.1038/srep32805

Table 2. Description, expression and putative target genes of known miRNAs whose expression were significantly down-regulated in roots of both Guiyan 1 (G) and Yunyan 2 (Y) treated with 50 μM Cd for 5 days.

Family name miRNA name Sequence Length (nt) TPMa
Fold changeb
Target gene Annotation
G−Cd G + Cd Y−Cd Y + Cd G Y
miR166 nta-miR166a UCGGACCAGGCUUCAUUCCCC 21 49481.3 17265.8 51937.0 6379.0 −1.5 −3.1 TC126889 PHAVOLUTA-like HD-ZIPIII protein (N. sylvestris)
nta-miR166b UCGGACCAGGCUUCAUUCCCC 21 49978.8 17303.7 51466.5 6467.4 −1.5 −3.0
nta-miR166c UCGGACCAGGCUUCAUUCCCC 21 49723.1 17629.6 51621.0 6216.5 −1.5 −3.1
nta-miR166d UCGGACCAGGCUUCAUUCCCC 21 49377.6 17569.0 51649.1 6725.6 −1.5 −3.0
nta-miR166e UCGGACCAGGCUUCAUUCCCC 21 49636.7 17318.9 52232.0 6618.6 −1.5 −3.0
nta-miR166f UCGGACCAGGCUUCAUUCCCC 21 50676.6 18054.1 52246.0 6390.7 −1.5 −3.1
nta-miR166g UCGGACCAGGCUUCAUUCCCC 21 50369.1 17152.1 53095.9 6446.0 −1.6 −3.1
nta-miR166h UCGGACCAGGCUUCAUUCCCC 21 49450.2 17091.5 53404.9 6560.9 −1.5 −3.1
miR6149 nta-miR6149a UUGAUACGCACCUGAAUCGGC 21 23011.6 8535.6 24061.7 5060.5 −1.5 −2.3 FS390832 TCTR2 protein (S. lycopersicum)

aTPM value indicates the expression level of miRNA; TPM value = counts of this miRNA/ total counts of this sample × 1000000.

bFold change (Cd vs control) is log2N, log2N ≥ 1.5 are up-regulated, between 0 < |log2N| < 1.5 are unchanged and log2N ≤ −1.5 are down-regulated, p < 0.01. G–Cd, G + Cd, Y − Cd and Y + Cd correspond to hydroponically grown tobacco of the cultivars Guiyan 1 and Yunyan 2 grown in basic nutrition solution (BNS) or BNS + 50 μM Cd.