Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers used for mutation in yellow catfish CypA. In both primers, the Asn amino acid is replaced by the Alan amino acid at position 69, which produced the CypAmt protein. The codons for Alan (GCT and AGC) are presented bold in both forward and reverse primers.
| Primer’s Name | Sequence (5′–3′) | Application |
|---|---|---|
| 69: AAT-GCT (Forward) | GTGACTTCACAGCTCACAACG | cDNA amplification |
| 69: AAT-GCT (Reverse) | GTGAGCTGTGAAGTCACCAC | cDNA amplification |
