Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primer sequences of autophagy-related genes.
| Gene | Forward primer | Reverse primer |
|---|---|---|
| Atg5 | atgacagatgacaaagatg | caacgtcaaataacttactc |
| Atg7 | tgacgatcggatgaatgagcc | gctcatgtcccagattttggaag |
| Atg12 | ctgtgtaattgcgtccccct | gaagctgcaacacagactgc |
| LC3-II | ccgcaccttcgaacaaagag | aagctgcttctcacccttgt |
| β-actin | tgacggggtcacccacactg | aagctgtagccgcgctcggt |
Atg, autophagy related; LC3, microtubule-associated protein light chain 3.
