Skip to main content
. 2016 Oct 4;214(Suppl 3):S192–S202. doi: 10.1093/infdis/jiw150

Table 1.

Primers and Probes Used in the Idylla™ Prototype Ebola Virus Test

Primer Name Position in Reference Sequence NCBI/GenBank Accession Number Oligonucleotide Sequence (5′–3′)
5EBO-GP_1D (sense) 6348–6369 NC_002549 TGGGCTGAAAAYTGCTACAATC
3EBO-GP_1D (antisense) 6440–6459 NC_002549 CTTTGTGMACATASCGGCAC
EBO-GP_1DZ-FIBFQ (antisense) 6421–6402 NC_002549 CCGTCTGGCGCTGCTGGTAG (56-FAM/3IAbkFQ)
EBO-GP_1DS-TRIBRQ (antisense) 6402–6420 NC_006432 CATCCGGCGGTGGGGGTAA (5TexRd-XN/3IAbRQSP)
PDV FW20 (sense) 20430–20452 NC_028249 GCTGTCTGGGTATACTTCTGATG
PDV_Rev20 (antisense) 20 578–20 599 NC_028249 CCTCCCCATTTGTATCTGACTG
PDV_Prb20 (antisense) 20 496–20 519 NC_028249 TTGTCATGGTCCCCTTCCTGTGTC (5ATTO647/3IABRQS)
RNaseP63fw (sense) 41–58 U77665 CAGATTTGGACCTGCGAG
RNaseP63rev (antisense) 87–103 U77665 CGGCTGTCTCCACAAGT
RNaseP63Pr (antisense) 65–83 U77665 CTGACCTGAAGGCTCTGCG (5TexRd-XN/3IAbRQSP)

Abbreviation: NCBI, National Center for Biotechnology Information.