Table 1.
Predicted miRNAs of tea
| miRNA family | EST ID | miRBase best hit ID | Mature sequencea | ML | MN | Ab | |||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| miR164*** | CV013669 | osa-miR164e | UGGAGAAGCAGGGCACGUGAG | 21 | 2 | 3’ | |||||
| miR169*** | GE650220 | osa-miR169n | AAGCCAAGAAUGACUUGCCa | 21 | 3 | 5’ | |||||
| miR1846* | DN976181 | osa-miR1846-5p | AUUGAGGAGGCCGGGaCuUCaU | 22 | 3 | 5’ | |||||
| miR1863* | GH623864 | osa-miR1863 | AGCUCUGAUACCAUaUUAGAaUAa | 24 | 3 | 5’ | |||||
| miRNA family | Precursor miRNAc |
PL (nt) | A (%) | C (%) | G (%) | U (%) | A+U (%) | G+C (%) | MFE | ||
| Start | End | ||||||||||
| miR164*** | 309 | 376 | 68 | 28 | 20 | 28 | 23.5 | 51.5 | 48.53 | 20 | |
| miR169*** | 442 | 492 | 51 | 22 | 18 | 25 | 35.3 | 56.9 | 43.14 | 7.8 | |
| miR1846* | 11 | 228 | 218 | 28 | 12 | 20 | 39.5 | 67.9 | 32.11 | 40.5 | |
| miR1863* | 377 | 448 | 72 | 33 | 8.3 | 25 | 35.3 | 66.7 | 33.33 | 19.2 | |
*
unique miRNA family registered in only one plant species in miRBase
***
highly conserved miRNA family registered in more than two plant species in miRBase.
a
Mature sequence of predicted miRNA. Lowercase represents the mismatch with the known miRNA sequence hit.
b
Location of the mature miRNA in the arm of the precursor sequence.
c
Location of the precursor sequence in the EST. ML, length of the mature miRNA sequence; MN, number of mismatches; PL, length of the precursor; A, C, G, U (%), adenine, guanine, cytosine, uracil nucleotide composition in the precursor miRNA; MFE, minimum free energy.