Skip to main content
. 2016 Oct 10;11(10):e0164463. doi: 10.1371/journal.pone.0164463

Fig 3. Primer utilisation patterns of the FMDV-5UTR forward primer using hot-start dNTPs.

Fig 3

Heat map of forward primer utilisation patterns using non-tailed (A and C) or tailed (B and D) primers. The heat map indicates the abundance of each primer variant for each FMDV isolate, with primers ordered by decreasing synthesis bias (A and B) or decreasing binding affinity (C and D). Primer variants are named according to the nucleotide bases present at the degenerate positions (e.g. primer variant TTGTG corresponds to the primer 5’- CACTTTAAGGTGACATTGGTACTGGTAC -3’).