Table 2.
Gene | Primer or probe* | Sequence (5′–3′) | Melting point (°C) | PCR product (bp) | Fluorochrome (5′ end) | Reference |
---|---|---|---|---|---|---|
lacY† | lacY-F | ACCAGACCCAGCACCAGATAAG | 59 | 104 | [19] | |
lacY-R | TTCTGCTTCTTTAAGCAACTGGC | 58.9 | Modified from [19] | |||
lacY-MGB-p1 | CATACATATTGCCCGCCAGTA | 70 | FAM | Modified from [19] | ||
lacY-MGB-p2 | CATACATATGCCCGCCAGA | 70 | FAM | Modified from [19] | ||
ipaH | ipaH-F | GACGGACAACAGAATACACTCCATC | 59.8 | 108 | Modified from [22] | |
ipaH-R | ATGTTCAAAAGCATGCCATATCTGT | 59.8 | [22] | |||
ipaH-MGB-p | CGGAAAACAAACAATCTGATGT | 69 | VIC | Modified from [22] |
*All probes were conjugated with minor groove binder (MGB) and had a “Black Hole Quencher” at the 3′ end
†Due to sequence variation in the lacY gene of certain EIEC strains, two different lacY probes were used to detect all EIEC strains [19]