Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Comparison of transcripts of 3-hydroxypropionic acid (3-HP) pathway genes between the wild-type and catabolite repression element (CRE) mutant in mid-log phase of growth, when resting cells were prepared. GACGGTGGGATGGTTATGTATG and AGGGTGAGCACCAAAGTAAAG, CGTTCACACTCACAGGTAGAAA and GCCATCAAGATCACCAGACA, GGAACGCGATGTGGAGATATT and AAGCCCTGAGTCTTCATTCATT were used as forward and reverse primers in Q-PCR for the amplification of pduP, pduL and pduW genes, respectively
