Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Direct sequencing results of LKB1 gene PCR Products. Arrow, mutation sites. (A) The mutation (c.48G>A) in exon 1. (B) The deletion (c.471_501delTTCTGTCAGCTGATTGACGGCCTGGAGTAC) in exon 4. (C) The mutation (c.701T>A in exon 4. (D) The mutation (c.1062C>G) in exon 8. (E) The mutation (c.924G>C) in exon 8. (F) The mutation (c.734+5G>A) in intron 5. (G) The mutation (c.374+24G>T) in intron 2. (H) The insertion (c.464+47_48insGGGGGCC) in intron 3. (I) The mutation (c.920+7G>C) in intron 7.
