Skip to main content
. 2016 Oct 19;11(10):e0164461. doi: 10.1371/journal.pone.0164461

Table 3. miRNAs expression in PP compared with NP animals.

Comparison miRNA name Chromosome Log2FC* PValue FDR Mature sequence
PP vs NP bta-mir-19b 12 -0.91 <0.001 0.002 UGUGCAAAUCCAUGCAAAACUGA
PP vs NP bta-mir-19b-2 X -0.89 <0.001 0.006 UGUGCAAAUCCAUGCAAAACUGA

* Log2 Fold Change in the positive group (PP) when compared with the exposed group (NP)