Table 3.
Sequences of oligonucleotide pairs
| Oligonucleotides | Sequences | Amplicon sizes (bp) |
|---|---|---|
| β‐actin‐F | cccgcgagtacaaccttct | 72 |
| β‐actin‐R | cgtcatccatggcgaact | |
| Cyclophilin‐F | tgctggaccaaacacaaatg | 88 |
| Cyclophilin‐R | cttcccaaagaccacatgct | |
| GFAP‐F | tttctccaacctccagatcc | 64 |
| GFAP‐R | gaggtggccttctgacacag | |
| Glutamine synthetase‐F | gaggcacagctgtaagcgtat | 68 |
| Glutamine synthetase‐R | cctgttccattccaaaccag | |
| Pou4f1‐F | ctccggaccttgagcttct | 60 |
| Pou4f1‐R | tagaagggagagttaaacacagaaca | |
| RPTPβ/ζ‐CA‐F | aaccatccttggaaaacacg | 66 |
| RPTPβ/ζ‐CA‐R | cattggtgagatttatttccactgt | |
| RPTPβ/ζ‐PTP1‐F | cctcgtggagaaaggaagaag | 77 |
| RPTPβ/ζ‐PTP1‐R | ccaggaagctcccgtattct | |
| Tenascin‐C‐F | gctctcctatggcatcaagg | 60 |
| Tenascin‐C‐R | tcatgtgtgaggtcgatggt | |
| Vimentin‐F | aacactcctgattaagacggttg | 72 |
| Vimentin‐R | tcatcgtggtgctgagaagt |
The primer pairs listed in the table were used in qRT‐PCR experiments. β‐actin and cyclophilin served as housekeeping genes for retinal samples. cyclophilin served as housekeeping gene in optic nerve samples. The predicted amplicon sizes are given.
F: forward; R: reverse.