. 2016 Oct 28;9:71. doi: 10.1186/s13048-016-0280-5

Table 2.

Primers used in the expression analyses of Bos taurus genes by PCR and RT-qPCR

Gene		Primer sequence (5′–3′)^a	Accesion no.	AS (bp)
GAPDH	Fwd	tgttccagtatgattccacccacg	NM_001034034	703
GAPDH	Rv	ggttgtctcctgcgacttcaacag
INHBA	Fwd	gctcatccctctcctttcact	NM_174363	171
INHBA	Rv	cgatcatgttctggatgtcct
LEPROTL1	Fwd	tactggcccctctttgttctg	NM_001037462	207
LEPROTL1	Rv	caagctccccactcgatcaaa
CDKN1B	Fwd	tgtcaaacgtgcgagtgtcta	NM_001100346	150
CDKN1B	Rv	ctctgcagtgcttctccaagt
JAK3	Fwd	gcacctccaagtgaggagac	XM_010806603	729
JAK3	Rv	cctctcgaggtccatgatgt

Abbreviations: AS amplicon size (base pairs), Fwd forward primer, Rv, reverse primer

^aAll primers were designed and validated by the authors. Each primer was used at a final concentration of 600 nM