Table 2.
Primers used in the expression analyses of Bos taurus genes by PCR and RT-qPCR
Gene | Primer sequence (5′–3′)a | Accesion no. | AS (bp) | |
---|---|---|---|---|
GAPDH | Fwd | tgttccagtatgattccacccacg | NM_001034034 | 703 |
Rv | ggttgtctcctgcgacttcaacag | |||
INHBA | Fwd | gctcatccctctcctttcact | NM_174363 | 171 |
Rv | cgatcatgttctggatgtcct | |||
LEPROTL1 | Fwd | tactggcccctctttgttctg | NM_001037462 | 207 |
Rv | caagctccccactcgatcaaa | |||
CDKN1B | Fwd | tgtcaaacgtgcgagtgtcta | NM_001100346 | 150 |
Rv | ctctgcagtgcttctccaagt | |||
JAK3 | Fwd | gcacctccaagtgaggagac | XM_010806603 | 729 |
Rv | cctctcgaggtccatgatgt |
Abbreviations: AS amplicon size (base pairs), Fwd forward primer, Rv, reverse primer
aAll primers were designed and validated by the authors. Each primer was used at a final concentration of 600 nM