Skip to main content
. 2016 Oct 31;11(10):e0164352. doi: 10.1371/journal.pone.0164352

Fig 2. Bioinformatic inference of putative human PPP1R12A, PPP1R12B and PPP1R12C LZ- isovariant sequences.

Fig 2

The publicly available sequence information for chicken and mouse PPP1R12ALZ- isovariants are shown to display the 31 nucleotide exonic insert ‘GTGTCCGGCAAGAGTCAGTATCTACTGGGCG’. This generates a shift in the reading frame and a LZ negative read is located at the start of the black lettered exon. Cross-alignment with the human published PPP1R12A, PPP1R12B and PPP1R12C sequences enabled identification of the region to theoretically insert the 31 nucleotides. Doing so resulted in the translated LZ negative protein sequence ‘V[X]GKSQYLLGG’ of the chicken and mouse sequences also appearing in the predicted human LZ- sequences.