Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Specifications of the primers used.
| Gene | Forward primer | Reverse primer | UPLprobe | Amplicon Size (bp) |
|---|---|---|---|---|
| GAPDH | tgggaagctggtcatcaac | gcatcaccccatttgatgtt | # 9 | 78 |
| IL-1α | aaatactcagctctttgtgagtgc | tgtgatgagttttggtgtttcc | #7 | 85 |
| TNF-α | tgaacttcggggtgatcg | gggcttgtcactcgagtttt | #63 | 122 |
| IL-10 | cagattccttactgcaggacttta | caaatgctccttgatttctgg | #13 | 128 |
| CD68 | acggacagcttacctttgga | aatgtccactgtgctgcttg | #21 | 118 |
| CD163 | atggggaaggcacaactg | tcagatccgctccgtctaa | #73 | 68 |
| CCR7 | tggctctcctggtcattttc | gccgatgtagtcgtctgtga | #29 | 65 |
