Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primer sequences and product size of genes.
| Gene | Primer sequences (5′-3′) | Product size |
|---|---|---|
| CD34 | F: caccctgtgtctcaacatgg | 191 bp |
| R: ggcttcaaggttgtctctgg | ||
| VE-cadherin | F: tgcccagaaaatgaaaaagg | 200 bp |
| R: gtgtatgtggcaatgcgttc | ||
| VEGF | F: cccactgaggagtccaacat | 173 bp |
| R: aaatgctttctccgctctga | ||
| β-actin | F: gctcttttccagccttcctt | 187 bp |
| R: gagccagagcagtgatctcc |
