Table 1.
Sequences and efficiency of primers used in current study
| Symbol | Gene name and function of encoded protein | Accession no. | Primer sequence 5′ → 3′ (forward/reverse) | Amp. size (bp) | E (%) |
|---|---|---|---|---|---|
| ACTB a | Actin, β; structural protein cytoskeleton | NM_001101.3 | F: caccattggcaatgagcggtt R: aggtctttgcggatgtccacgt |
135 | 104.2 |
| B2M a | β-2-microglobulin; β-chain of MHC class I molecules | NM_004048.2 | F: ccactgaaaaagatgagtatgcct R: ccaatccaaatgcggcatcttca |
126 | 95.7 |
| GAPDH a | Glyceraldehyde-3-phosphate dehydrogenase; enzyme of glycolytic pathway | NM_002046.4 | F: gtctcctctgacttcaacagcg R: accaccctgttgctgtagccaa |
131 | 105.8 |
| GUSB | β-Glucuronidase, lysosomal exoglycosidase | NM_000181 | F: ctgtacacgacacccaccac R: attcgccacgactttgtt |
159 | 92.6 |
| HPRT1 | Hypoxanthine phosphoribosyl-transferase; purine metabolism | NM_000194.2 | F: tgacactggcaaaacaatgca R: ggtccttttcaccagcaagct |
94 | 105.1 |
| IPO8 | Importin 8; nuclear protein import | NM_006390.3 | F: tggtatggtggaagtgtaagaagtg R: ttggttgagatagttgaatgcttgc |
230 | 107.1 |
| MRPL19 a | Mitochondrial ribosomal protein L19 | NM_014763.3 | F: caggaagaggacttggagctac R: gctatcatccagccgtttctcta |
137 | 93.8 |
| PGK1 a | Phosphoglycerate kinase 1; glycolytic enzyme | NM_000291.1 | F: ccgctttcatgtggaggaagaag R: ctctgtgagcagtgccaaaagc |
149 | 107.1 |
| PPIA a | Peptidylprolyl isomerase A; protein folding | NM_021130.3 | F: ggcaaatgctggacccaacaca R: tgctggtcttgccattcctgga |
161 | 104.6 |
| RPLP0 a | Ribosomal protein, large, P0; component of 60S subunit | NM_001002.3 | F: tggtcatccagcaggtgttcga R: acagacactggcaacattgcgg |
119 | 106.4 |
| RPS23 a | Ribosomal protein S23; component of 40S subunit | NM_001025.4 | F: aggaagtgtgtaagggtccagc R: caccaacagcatgacctttgcg |
142 | 106.9 |
| SDHA | Succinate dehydrogenase subunit A; subunit of respiratory chain complex | NM_004168.2 | F: agaggcacggaaggagtcac R: caccacatcttgtctcatcagtagg |
267 | 95.9 |
| TBP | TATA-box-binding protein; general transcription factor | NM_003194.4 | F: tataatcccaagcggtttgctg R: ctggctcataactactaaattgttg |
283 | 102.2 |
| UBC | Ubiquitin C; protein degradation | NM_021009.5 | F: ggaacaggcgaggaaaagtagtc R: gtcttaccagtcagagtcttcacg |
209 | 96 |
| YWHAZ | Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide; signal transduction | NM_003406.3 | F: tcacaacaagcataccaagaagc R: gtatccgatgtccacaatgtcaag |
263 | 97.4 |
Remaining primers were designed using Beacon Designer Probe/Primer Design Software (BioRad) as previously described (manuscript submitted)
Forward and reverse primer sequences are denoted by “F” and “R”, respectively
Amp. amplicon, E efficiency
a primer sequences were as proposed by Origene (www.origene.com)