Table 1.
Primers and Probes Used in qPCR
| Gene | Gene Location | Primer Sequences (5′-3′) | UPL Probe | Amplicon Size (bp) | Primer Efficiency (%) |
|---|---|---|---|---|---|
| NPHP4 | 1p36 | F: ccggcctatcgtcactttt R: gccggtgtgtgcagaact |
8 | 60 | 94 |
| CHD1L | 1q12 | F: aaaaacctaagtaacagagggacatt R: tgtatctatgttgttgggattcatact |
56 | 69 | 101 |
| RELL1 | 4p14 | F: tgcttgctcagaaggagctt R: tgggttcaggaacagagaca |
12 | 64 | 94 |
| DPPA3 | 12p13.31 | F: cgtagcgtcgttgcatca R: tcctttttaccgttcctgaca |
60 | 63 | 96 |
| LGR5 | 12q21.1 | F: gatatgttggggattgacacg R: tgctcaaagaggacaaccttc |
6 | 60 | 109 |
| FLCN | 17p11.2 | F: tgcagtccacaatgacaagtg R: ccatgagagccgaagactgt |
68 | 74 | 101 |
| TK1 | 17q23.2-q25.3 | F: ggtgacagctgcttacagcttag R: actggttgccaccttctcag |
60 | 64 | 101 |
| BCL2L1 | 20q11.21 | F: tctgcagaaggctaccccta R: tgctgtgtctaagacctctttcat |
44 | 75 | 111 |
Gene name and location, primer sequences, and Universal Probe Library (UPL) probes used for amplification of target sequences. F, forward primer; R, reverse primer.