Table 2.
Cold shock-induced differential expression of known miRNAs
| miRNA | Mature miRNA sequence | Fold change |
|---|---|---|
| Up-regulated miRNAs | ||
| Dre-mir-29b-1 | UAGCACCAUUUGAAAUCAGUGU | 3.90 |
| Dre-mir-99-2 | AACCCGUAGAUCCGAUCUUGUG | 2.04 |
| Dre-mir-99-1 | AACCCGUAGAUCCGAUCUUGUG | 1.79 |
| Dre-mir-92a-2 | UAUUGCACUUGUCCCGGCCUGU | 1.75 |
| Dre-mir-2184 | AACAGUAAGAGUUUAUGUGCU | 1.73 |
| Down-regulated miRNAs | ||
| Dre-mir-737 | AAUCAAAACCUAAAGAAAAUA | −1.71 |
| Dre-mir-9-2 | UCUUUGGUUAUCUAGCUGUAUGA | −1.75 |
| Dre-mir-363 | AAUUGCACGGUAUCCAUCUGUA | −1.79 |
| Dre-mir-125b-2 | UCCCUGAGACCCUAACUUGUGA | −1.91 |
| Dre-mir-199-1 | CCCAGUGUUCAGACUACCUGUUC | −2.79 |
After eliminating miRNAs whose expression might be changed due to development process during incubation (control vs normal). The top 5 of 29 up- and 26 down-regulated known miRNAs (annotated in miRBase v18) are shown, along with their sequences and fold changes compared to the control groups