Table 1. Primer sequences and product size of RT-PCR.

Protein	Primer	Sequence (5'→3')	Product size/bp
K3	Type II intermediate filaments in mammalian cells during differentiation and stratified epithelial cells	GACAATAATCGTTCCCTGGTTGCGGTAGGTGGCGATCT	434
K14	Type I intermediate filaments in inmature cells of stratified epithelial cells	ACTACCTGCAGCCGCCAGTTCAGTTCTTGGTGCGAAGGAC	1 417
p63	Tumour suppressor gene in inmature cells of stratified epithelial cells	CAGACTCAATTTAGTGAGGTGCCCCAACCATGAGCT	440
Pax7	Paired box transcription factor family member involved in maintaining proliferation and preventing differentiation in skeletal muscle progenitor cells	ATCCGGCCCTGTGTCATCTCCACGCGGCTAATCGAACTCA	278
CD34	Hematopoietic stem cell marker. CD34 expressed in quiescent adult skeletal muscle satellite cells	AATCTAGCCCAGTCTGAGGTCTTTCGGGAATAGCTCTGGT	174
Desmin	Type III intermediate filament in skeletal, smooth and cardiac muscle tissue	TGCAGGAGCTCAATGACCTCGATGCGAGCTAGTGTG	337
MyoD	A protein with a key role in regulating muscle differentiation	GCTCGCGAGGATGAGCATGTATGGCGTTGCGCAGGATCTC	239
GAPDH	Glyceraldehyde-3-phosphate dehydrogenase, internal control	ACCACAGTCCATGCCATCACTCCACCACCCTGTTGCTGTA	452

RT-PCR, reverse transcriptase polymerase chain reaction.