Figure 3. Post-translational silencing mediated by the intron-encoded C-terminal tail.

(A) Schematic of HAC1 mRNA splicing. The proteins encoded by HAC1^u and HAC1ⁱ mRNAs differ in their C-terminal tails, with the amino acid sequences indicated. (B) Design of reporter mRNAs. Black shading indicates recoding, with the original and recoded sequences depicted below (mutations in red). Untranslated regions colored red correspond to those of the TMA7 mRNA, with the reporter gene integrated at the TMA7 rather than HAC1 locus. Otherwise constructs are depicted as in Figure 2B. (C) Flow cytometry analysis of reporter strains. Strains expressing the GFP reporter mRNAs depicted in (B) were analyzed as in Figure 2C, with data for the first three strains duplicated from Figure 2B for comparison. (D) Polysome analysis of reporter mRNAs. Extracts were prepared in heparin-containing lysis buffer from strains expressing the GFP reporter mRNAs indicated in (B). Polysome analysis was performed as in Figure 1A, with data for the wild-type and intronless GFP reporters from Figure 2A duplicated for comparison. (E) Differentiating between co-translational and post-translational silencing mechanisms. Left: Schematic of reporter construct that generates two separate polypeptides from each round of translation. Right: Extracts were prepared from strains expressing reporter mRNAs that either encoded the 10-amino-acid C-terminal tail of Hac1^up (+tail) or contained a stop codon just before the tail (–tail). Immunoblotting was used to detect HA-tagged mRuby (top) and GFP (bottom), with actin as a loading control. Two biological replicates are shown for each genotype.

DOI: http://dx.doi.org/10.7554/eLife.20069.007

Figure 3—figure supplement 1. Additional analyses of GFP reporter constructs.

(A) RNA abundance measurements for GFP reporter mRNAs, analyzed as in Figure 2—figure supplement 1A using the same cultures as for flow cytometry analyses in Figure 3C. (B) Flow cytometry and RNA analyses of additional reporter strains. Strains expressing the indicated GFP reporter mRNAs (left) were analyzed by flow cytometry as in Figure 2C (middle) or qRT-PCR as in Figure 2—figure supplement 1A (right), with data for the first four strains duplicated from Figure 3C and Figure 3—figure supplement 1A for comparison.

DOI: http://dx.doi.org/10.7554/eLife.20069.008

Figure 3—figure supplement 2. Identifying a 2A peptide sequence that is active in S. cerevisiae.

(A) Design of the 2A reporter construct. In the absence of 2A activity, a 57–58 kDa polypeptide (*) is produced that contains both an HA tag and GFP. When the 2A sequence is active, translation of the reporter generates a 30–31 kDa HA-tagged protein and a 27 kDa GFP. Shown are the 30-amino-acid sequences of the 2A peptides that were tested, with each preceded by a GlySerGly linker (gray) and ‘cleaved’ at the site marked with an arrow. The region corresponding to a minimal 20-amino-acid T2A peptide (‘minT2A’) that has been used previously in yeast (Beekwilder et al., 2014) is indicated. Minimal versions of the F2A peptide have also been used in yeast (Doronina et al., 2008; de Felipe et al., 2003; Sharma et al., 2012; Voordeckers et al., 2012) but with ‘cleavage’ efficiencies that were low or not directly measured. (B–C) Analysis of 2A activity by immunoblotting. BY4741 was transformed with a pRS413-derived centromeric plasmid containing the indicated reporter construct under control of the GPD promoter. Proteins were extracted from mid-log-phase cultures and analyzed for HA- (B) and GFP- (C) tagged proteins by immunoblotting. Only the P2A peptide causes efficient separation of the upstream and downstream proteins (indicated by arrows). The nucleotide sequences encoding the 30-amino-acid peptides are:

F2A: CACAAACAAAAGATTGTTGCGCCTGTGAAACAGCTTTTGAACTTTGACCTGCTCAAGTTGGCAGGAGACGTCGAGTCCAACCCTGGGCCT

E2A: AGACATAAATTTCCCACTAACATCAACAAACAGTGTACTAATTACTCTCTCCTCAAATTGGCTGGAGATGTTGAGAGCAACCCTGGC CCC

P2A: GCTATGACTGTGATGACATTCCAGGGACCAGGTGCAACAAACTTCTCCCTCTTGAAACAAGCAGGAGATGTTGAGGAAAATCCCGGGCCT

T2A: CGGGGGCCTCGCCCCCAAAACCTTGGGGTAAGGGCCGAGGGCAGGGGAAGTCTTCTAACATGCGGGGACGTGGAGGAAAATCCCGGCCCC

DOI: http://dx.doi.org/10.7554/eLife.20069.009