Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers utilized for sq-RT-PCR
| Gene | Sense | Antisense |
|---|---|---|
| β-Actin | agctacgagctgcctgacgg | gatccacacggagtacttgcg |
| Cyclin D1 | gtgcagaaggaggtcctgcc | gcttgttcaccaggagcagc |
| Cyclin E1 | gaggaaggcaaacgtgaccg | gctcaagaaagtgctgatccc |
| ZBTB33 | tggagcgacgtttaaagaaggg | ctgaaagaatattcttgtgagcc |
