Figure 2.

DNA sequencing. Genomic DNA was extracted from the blood of two patients, their two parents and a normal individual as control (A) using the Invitrogen DNAzol BD reagent. The seven exons of the STARD1 gene were PCR and sequenced. A mutation was found in exon 7. For exon 7 oligonucleotides used for PCR were (5′ to 3′) ATGAGCGTGTGTACCAGTGACG, (5′ to 3′) CCTGGCAGCCTGTTTGTGATAG; the annealing temperature was 60°C and the reaction processed for 30 cycles. The PCR products were sequenced. The mutation found in exon 7 was located at the amino acid residue 275, a leucine being substituted by a proline. The two parents (B,C) were +/−, and the two children (D,E) were −/−.