TABLE 3.
Identification of potential AdcR regulon members based on in silico Streptococcus agalactiae A909 genome scanning
| Position(s)a | Gene ID and/or name | Function(s) | Pattern sequenceb |
|---|---|---|---|
| −126 | sak_0087; adh | Alcohol dehydrogenase | TTAAAGATTAACCAGTTAAGAATA |
| −28 | sak_0217; adcR | Repressor, zinc metabolism | TATAATTTACTGGTTAACAAAA |
| −96 | sak_0252 | Binding protein, peptide/nickel ABC transporter | TCTAATTAACCAGTTAAGTAAT |
| −28 and −39 | sak_0685; adcA | Binding protein, zinc ABC transporter | AAATATTAACCGGTAAATAACGGGTTAAATAAA |
| −50 | sak_0693 | Similar to surface proteins (LPXTG motif) | AAAACTTAACCGGTTAATTATT |
| −42 | sak_1023 | Similar to histidine triad protein, putative internalin | TATAATTAACTAGTTAACTAAA |
| −32 and −43 | sak_1319; lmb | Binding protein, zinc ABC transporter | TAAAATTAACTGGTTAATAACTGGTTAAATTAT |
| −52 | sak_1468 | Similar to flavoprotein, involved in K+ transport | TATTGTTAACTGGTTAAGTATT |
| −39 | sak_1469 | Similar to ammonium transporter | AATACTTAACCAGTTAACAATA |
| −340 | sak_1542 | Binding protein, peptide/nickel ABC transporter | TATACTTAACTGGTTAAGTATA |
| −38 | sak_1898; adcAII | Binding protein, zinc ABC transporter | AAATGTTAACTGGTTAAGTATT |
a
Nucleotide numbering is from the start codon of the gene to the end of the putative AdcR binding site.
b
Nucleotides in bold indicate the putative AdcR binding site.