Table 1.
Presence of repetitive G-quadruplex motif (RGQM) in herpesvirus genome
| Virus name | Sequence | Nucleotide position | n[max] | Percentage Conservation | Genome Location |
|---|---|---|---|---|---|
| HHV-1 | GGGAGGAGCGGGGGGAGGAGCGGG | 106–286 & 151968–152136 | 7 | 87.5 | Repeat region |
| GGGAGTGGGGGTGCGTGGGAGTGGGGG | 5725–5873 | 7 | 87.5 | Repeat region | |
| GGGGCTGGGGTTGGGGTTGGGG | 71612–71792 | 8 | 100 | Repeat region | |
| GGGGAGTGGGTGGGTGGGGAGTGGG | 143736–143833 | 4 | 100 | Repeat region | |
| GGGGGCGAGGGGCGGGAGGGGGCGAGGGGa | 25142–25448 | 8 | 87.5 | Repeat region | |
| GGGGAGGGCTGGGGCCGGGGAGGGCTGGGGa | 25537–25692 | 3 | 100 | Repeat region | |
| GGGAGGAGCGGGGGGAGGAGCGGGa | 26009–26177 | 8 | 75 | Repeat region | |
| HHV-2 | GGGGCGGCTGGGGCAGGGGCGGCTGGGG | 72102–72222 | 3 | 100 | Repeat region |
| GGGGGGACGGGGGGACGGGGGGACGGGGGG | 133385–133489 | 5 | 100 | Repeat region | |
| GGGGGTCGGGCGGGCGGGGGTCGGG | 153828–154066 | 8 | 100 | Repeat region | |
| GGGGGGCCGGGGGGACGGGGGGACGGGGGGa | 6406–6502 | 4 | 75 | Repeat region | |
| HHV-6A | GGGTTAGGGTTAGGGTTAGGGa | 75–411 & 151327–151645 | 14 | 100 | Repeat region |
| HHV-6B | GGGTTAGGGTTAGGGTTAGGGa | 77–521, 8459–8669, 153410–153842, 161780–161990 | 18 | – | Repeat region |
| HHV-7 | GGGTTAGGGTTAGGGTTAGGGa | 82–222, 5938–8907, 8985–9923, 9195–9243, 9387–9651, 143128–143262, 148984–151965, 152031–152169, 152253–152349, 152445–152715 | 82 | 100 | Repeat region |
| HHV-8 | GGGATGGGGGTGTGGGATGGGGG | 29928–30032 | 5 | 80 | Repeat region |
n[max] is the maximum number of iterations (n[max]) of a given RGQM
The percent conservation of each RGQM indicated in the tables is based on the presence of a minimum of three iterations of a given RGQM in all available sequences [i.e., HHV-1 (n = 8), HHV-2 (n = 3), HHV-3 (n = 52), HHV-4 (n = 5), HHV-5 (n = 47), HHV-6A (n = 3), HHV-6B (n = 1), HHV-7 (n = 2), HHV-8 (n = 5) for a given virus.]
aRGQM present in the reverse complement of the strand represented in NCBI