Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
List of LNA probes and RNA Tm-values for miRNA.
| miRNA name | Probe sequence (5′ to 3′) | Exiqon RNA Tm (°C) | Product no. in Exiqon |
|---|---|---|---|
| miR-124a | 5DigN/GGCATTCACCGCGTGCCTTA | 90 | 88066-01 |
| miR-181a | 5DigN/ACTCACCGACAGCGTTGAATGTT | 85 | 18066-01 |
| miR-34a | 5DigN/ACAACCAGCTAAGACACTGCCA | 85 | 38487-01 |
| miR-34c | 5DigN/GCAATCAGCTAACTACACTGCCT | 86 | 38542-01 |
| miR-9 | 5DigN/TCATACAGCTAGATAACCAAAGA | 78 | 18198-01 |
| miR-100 | 5DigN/CACAAGTTCGGATCTACGGGTT | 83 | 18009-01 |
| miR-219 | 5DigN/AGAATTGCGTTTGGACAATCA | 78 | 38497-01 |
