TABLE 2.
Primers used in this study
| Primer | DNA sequence (5′ to 3′)a | Description |
|---|---|---|
| pnr-F | GGAATTCCATATGATCAAAACAAACGATTTTATGG | Forward primer to amplify pnr with a NdeI site |
| pnr-R | CCGCTCGAGTTTCCATTCTGCAATTGTATCAATC | Reverse primer to amplify pnr with a XhoI site |
| RT-16SF | CCAGCATTCAGTTGGGCACTCTAAG | Forward primer of quantitative real-time PCR to amplify a 173-bp fragment of 16S rRNA sequence |
| RT-16SR | ACTGAGAACAGATTTGTGGGATTGG | Reverse primer of quantitative real-time PCR to amplify a 173-bp fragment of 16S rRNA sequence |
| RT-PF | GCCGCCGTTCTATTCGCAACTATG | Forward primer of quantitative real-time PCR to amplify a 113-bp fragment of pnr sequence |
| RT-PR | CCATGGCTGCGCGTTAACAGAAGAT | Reverse primer of quantitative real-time PCR to amplify a 113-bp fragment of pnr sequence |
a
Underlined sequences refer to the restriction sites.