REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Rabbit monoclonal anti-eEF1A1 antibody	Abcam	Cat. #ab140632
Rabbit polyclonal anti-uL6 antibody	Santa Cruz	Cat. #102085; RRID: AB_2182219
Rabbit polyclonal anti-uS9 antibody	Santa Cruz	Cat. #sc-102087; RRID: AB_2269633
Chemicals, Peptides, and Recombinant Proteins
3XFlag-TEV WT Hbs1l (human)	Shao et al., 2013	N/A
3XFlag-TEV H348A Hbs1l-DN (human)	Shao et al., 2013	N/A
3XFlag-TEV eRF3a (human)	This study	N/A
WT eRF1 (human)	This study	N/A
eRF1(AAQ) (human)	Brown et al., 2015b	N/A
His-Pelota (human)	Shao et al., 2013	N/A
E. coli Poly(A) polymerase	New England Biolabs	Cat. #M0276L
3X Flag peptide	Sigma-Aldrich	Cat. #F4799
Anti-Flag M2 affinity resin	Sigma-Aldrich	Cat. #A2220
Ni-NTA agarose	QIAGEN	Cat. #30210
Didemnin B	This study (Jack Taunton)	CAS #77327-05-0
Cycloheximide	Sigma-Aldrich	Cat. #C4859; CAS #66-81-9
Emetine	Calbiochem	Cat. #324693; CAS #316-42-7
Anisomycin	Sigma-Aldrich	Cat. #A9789; CAS #22862-76-6
EasyTag L-[35S]-Methionine	Perkin Elmer	Cat. #NEG709A005MC
CAP (diguanosine triphosphate cap)	New England Biolabs	Cat. #S1404L
RNasin	Promega	Cat. #N251
SP6 polymerase	New England Biolabs	Cat. #M0207L
Creatine kinase	Roche	Cat. #127566
Creatine phosphate	Roche	Cat. #621714
Amino acid kit	Sigma	Cat. #09416
Deposited Data
80S⋅empty A site density map	This study	EMDB: 4129
80S⋅aa-tRNA⋅eEF1A density map	This study	EMDB: 4130
80S⋅eRF1⋅eRF3 density map	This study	EMDB: 4131
80S⋅eRF1 density map	This study	EMDB: 4132
80S⋅eRF1⋅ABCE1 (combined) density map	This study	EMDB: 4133
80S⋅Pelota⋅Hbs1l (truncated mRNA) density map	This study	EMDB: 4134
80S⋅Pelota⋅Hbs1l (stop mRNA) density map	This study	EMDB: 4135
80S⋅Pelota⋅Hbs1l (polyA mRNA) density map	This study	EMDB: 4136
80S⋅Pelota⋅Hbs1l (combined) density map	This study	EMDB: 4137
80S⋅aa-tRNA⋅eEF1A atomic model	This study	PDB: 5LZS
80S⋅eRF1⋅eRF3 atomic model	This study	PDB: 5LZT
80S⋅eRF1 atomic model	This study	PDB: 5LZU
80S⋅eRF1⋅ABCE1 (combined) atomic model	This study	PDB: 5LZV
80S⋅Pelota⋅Hbs1l (truncated mRNA) atomic model	This study	PDB: 5LZW
80S⋅Pelota⋅Hbs1l (stop mRNA) atomic model	This study	PDB: 5LZX
80S⋅Pelota⋅Hbs1l (polyA mRNA) atomic model	This study	PDB: 5LZY
80S⋅Pelota⋅Hbs1l (combined) atomic model	This study	PDB: 5LZZ
Experimental Models: Cell Lines
HEK293T	ATCC	CRL-3216
Experimental Models: Organisms/Strains
E. coli BL21 (DE3)	Thermo Fisher	C600003
E. coli BL21 (DE3) pLysS	Thermo Fisher	C606003
Recombinant DNA
pcDNA 3XFlag-TEV WT Hbs1l	Shao et al., 2013	N/A
pcDNA 3XFlag-TEV H348A Hbs1l	Shao et al., 2013	N/A
pcDNA 3XFlag-TEV eRF3a	This study	N/A
pRSETA 6XHis-TEV eRF1	This study	N/A
pRSETA 6XHis-TEV eRF1(AAQ)	Brown et al., 2015b	N/A
pSP64 3XFlag VHP Sec61-UGA(68)	Brown et al., 2015b	N/A
pSP64 3XFlag VHP Sec61-68	Shao et al., 2013	N/A
pSP64 3XFlag KRas	This study	N/A
Primer: SP64 5′ Fwd: TCATACACATACGATTTAGG	Sharma et al., 2010	N/A
Primer: SP64 Rev: CAATACGCAAACCGCCTC	Sharma et al., 2010	N/A
Primer: Val68 Rev: AACTTTGAGCCCAGGTGAATC	Shao et al., 2013	N/A
Software and Algorithms
EPU software	FEI	https://www.fei.com/software/epu/
Motioncorr	Li et al., 2013	http://cryoem.ucsf.edu/software/driftcorr.html
Gctf v0.5	Zhang, 2016	http://www.mrc-lmb.cam.ac.uk/kzhang/Gctf/
RELION v1.4	Scheres, 2015	http://www2.mrc-lmb.cam.ac.uk/relion
ResMap v1.1.4	Kucukelbir et al., 2014	http://resmap.sourceforge.net/
Coot v0.8	Emsley et al., 2010	http://www2.mrc-lmb.cam.ac.uk/personal/pemsley/coot/
REFMAC v5.8	Murshudov et al., 2011	https://www2.mrc-lmb.cam.ac.uk/groups/murshudov/content/refmac/refmac.html
MolProbity v4.3	Chen et al., 2010	http://molprobity.biochem.duke.edu/
Phenix.elbow dev-2499	Adams et al., 2010	http://www.phenix-online.org/documentation/reference/elbow.html
UCSF Chimera v1.10.2	Pettersen et al., 2004	https://www.cgl.ucsf.edu/chimera/
PyMOL v1.7	Schrödinger, LLC	http://www.pymol.org
Other
RRL in vitro translation mix	Sharma et al., 2010	N/A
TransIT 293	Mirus	MIR 2705