Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Sequences of primers for amplification of CYP2C19* 17 allele by RFLP and HRM methods
| Technique | Primer name | Sequence | Length (bp) | Tm |
|---|---|---|---|---|
| HRM | ||||
| CYP2C19*17-F | 5- TGACAAGACACAGACTGGGA -3 | 20 | 58.2 | |
| CYP2C19*17-R | 5- CGGGGTTTTAGCTTGCAGTT -3 | 20 | 59 | |
| PCR-RFLP | ||||
| 2C19-17-F | 5-TACAATGAAGGCACAATC-3 | 18 | 50 | |
| 2C19-17-R | 5-CAAGGAGCACAACTACTAGATA-3 | 22 | 54.7 | |
