Table 1.
List of primers used for RT-qPCR
| Gene | Accession number | 5′ OLIGO | 3′ OLIGO | Gene function in the brain/gut context |
|---|---|---|---|---|
| CLDN-1 | NM_021101 | GTGATAGCAATCTTTGTGGC | ACTAAAATAGCCAGACCTGC | Barrier-forming claudin |
| CLDN-5 | NM_001130861 | GAACTTCCTGAAGTGGTGTC | CCAGACCTCTCAATCTTCAC | Barrier-forming claudin; endothelial cell-specific |
| CLDN-12 | NM_001185072 | GAGAAGCAGGCTCAGATTAT | AGATTCAGAACTTCCCTGTG | Function at BBB unknown |
| OCLN | U53823 | CACACCACACCTACACTC | TCCAAGATAAACCAATCTGCT | Barrier-forming component of the TJs |
| VE-Cad | X79981 | AGTTCTTCCGAGTCACAAAA | TCAGGTTATACCAGGGGTAG | Main integral membrane protein of endothelial AJs; controls endothelial cell survival, stabilization of blood vessel assembly, and vascular permeability |
| MMP-9 | NM_004994 | TGTACCGCTATGGTTACACTCG | GGCAGGGACAGTTGCTTCT | Metalloprotease involved in local proteolysis of the extracellular matrix and in leukocyte migration |
| MMP-2 | NM_004530 | TACAGGATCATTGGCTACACACC | GGTCACATCGCTCCAGACT | Metalloprotease involved in local proteolysis of the extracellular matrix and in leukocyte migration |
| tPA | NM_001319189 | CCGGCTACGGCAAGCA | AGCGGCTGGATGGGTACA | Serine protease involved in the synthesis of MMPs and BBB damage |
| 18S | X03205 | AGAAACGGCTACCACATCCA | CCCTCCAATGGATCCTCGTT | Ribosomal RNA (control gene for qPCR) |
| CLDN-2 | NM_001171092 | QIAGEN | Pore-forming claudin; regulates paracellular ion and water flow | |
| CLDN-3 | NM_001306 | QIAGEN | Barrier-forming component of the TJs | |
| CLDN-10 | NM_001160100 | QIAGEN | Pore-forming claudin; regulates paracellular ion flow | |
| CLDN-15 |
NM_001185080 NM_014343 NM_138429 |
QIAGEN | Pore-forming claudin; regulates paracellular ion flow | |
| TRIC | NM_001038603 | QIAGEN | Barrier-forming component of the TJs | |
| IL-1b | NM_000576 | QIAGEN | Pro-inflammatory cytokine involved in increased BBB permeability | |
| IL-6 | NM_000600 | QIAGEN | Pro-inflammatory cytokine | |
| IL-8 | NM_000584 | QIAGEN | Pro-inflammatory cytokine | |
| IL-10 | NM_000572 | QIAGEN | Anti-inflammatory cytokine | |
| TSPO | NM_000714 | QIAGEN | Mitochondrial protein expressed on reactive glial cells; biomarker for inflammation in the brain | |
| tTG6 | NM_001254734 | QIAGEN | Marker of gluten-related neuroinflammation | |
| MSFD2A | NM_001136493 | QIAGEN | Key regulator of BBB function; required for the establishment of a functional BBB | |
| IBA-1 | NM_001623 | QIAGEN | Marker of microglia activation | |