Table 3.
EMSA Oligos.
|
Primer pair |
Forward |
|---|---|
|
m18RE |
ggctcgcaggtccacgccccttggcaccggag |
|
m18RE* |
ggctcgcaggtccaaaccccttggcaccggag |
|
Sp Consensus |
attcgatcggggcggggcgagc |
|
Sp* Consensus |
attcgatcggttcggggcgagc |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.