Extended Data Figure 6.
Characterization of the npr1-6 mutant. a, A diagram showing the T-DNA insertion site in the npr1-6 mutant. Blue boxes indicate exons in the NPR1 gene. b, RT-PCR results showing that the npr1-6 line cannot produce the full-length NPR1 transcript. Primers used (NPR1 sequence is underlined): NPR1-F: agaattcATGGACACCACCATTGATGGA; NPR1-R: agtcgacCCGACGACGATGAGAGARTTTAC; UBC21-F: TCAAATGGACCGCTCTTATC; UBC21-R: TCAAATGGACCGCTCTTATC. Uncropped gel images are included in Supplementary Figure 1. c, The npr1-6 line, similar to npr1-1, is greatly compromised in benzothiadiazole (BTH)-mediated resistance to Pst DC3000 infection. The Col-0, npr1-1 and npr1-6 plants were sprayed with 100μM BTH and, 24 h later, dip-inoculated with Pst DC3000 at 1×108 cfu/ml. Bacterial populations were determined 3 days post inoculation. * indicates a significant difference between mock and BTH treatment, as determined by Student’s t-test (two-tailed); *, p=0.027; ***, p=1.6×10−4; ns, not significant (p=0.19). n=3 technical replicates; error bars, mean±s.d. Experiments were repeated three times.