Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Sequence polymorphisms in the RPP27 region between Col-0 and Ler-0
| Nucleotide Positiona | Col-0 | Ler-0 |
|---|---|---|
| −1,044 | A | G |
| −1,024 | A | – |
| −949 | A | G |
| −877 | A | – |
| −512 | – | G |
| −412 | T | C |
| 412b | C | T |
| 486b | A | G |
| 1,799b | T | C |
| 2,574c | – | CGAGTACCAGAAAAACTTGCGTCTAGTTGATCTATCCAACAACAGATTATCTGGAAACCTACCTACAT |
| 4,576 | – | T |
Nucleotide positions are numbered with respect to translational start site.
Polymorphism is in the intron.
Polymorphism is in the exon.
–, Deletion.
