Figure 3. Cellular localization, DNA binding property to RUNX2 and overexpression of WT-DLX3, MT-DLX3 or TR-DLX3 in MC3T3-E1 cells.

(A) Panels showing EGFP and EGFP-DLX3 fusion protein expression in MC3T3-E1 cells 48 h after transfection with pEGFP-C1, pWT-DLX3, pMT-DLX3 and pTR-DLX3. Differential interference contrast (DIC) images were acquired to visualize cell shape (a, d, g and j). Images of EGFP expression (b, e, h and k) were detected by fluorescent microscope. WT-DLX3, MT-DLX3 or TR-DLX3 was located in nuclear while the EGFP was in cytoplasm, which was shown in the merged images (c, f, i and l). (B) DLX3 mRNA expression was highly enhanced in WT-DLX3, MT-DLX3 and TR-DLX3 compared with EGFP-EV after 48 h transfection by real-time PCR. (C) DLX3-GFP protein expression was detected by western blot analysis with anti-DLX3 (a) and anti-EGFP (b) antibodies after 48 h transfection. Only EGFP protein was detected in EGFP-EV samples. EGFP-DLX3 fusion protein was detected in WT-DLX3, MT-DLX3 and TR-DLX3 samples. Data were presented as the mean ± S.D. of 3 independent experiments. **p < 0.01; Scale bars = 100 μm. (D) DLX3 occupies its affinity site in the RUNX2 promoter. EMSA assay was performed by using a biotin-labeled double-stranded probe (containing the DLX3 affinity site). Nuclear extracts (10 μg) from HEK 293 T cells expressing GFP-WT-DLX3, GFP-MT-DLX3 or GFP-TR-DLX3 were used. The wild type probe (GCATTTTGTAATTTATTTCAAAGC) and the mutant probe (GCATTTTGTGGGTTATTTCAAAGC) were used as unlabeled competitors at a 100-fold excess. The presence of specific complexes, including supershifted GFP/DLX3 in the complexes, are indicated.