Skip to main content
. 2016 Jun 9;7(6):e2259. doi: 10.1038/cddis.2016.147

Table 1. Mutations on the ATP2C1 gene reported in the literature.

Exon/Intron Nucleotide change Mutation Numbera Codonb Effect Domainc References
Exon 2 28delG/ins24bpd Deletion/insertion 1   PTC N-ter 6, 23 d
Exon 2d 115C>T Nonsense 4 R39X PTC N-ter/s1 6, 18, 19
Intron 2 117+2T>G Donor splice 1   PTC(?) N-ter/s1 95
Intron 2 118-2A>G Acceptor splice 1   PTC N-ter/s1 96
Intron 2 118-1G>A Acceptor splice 3     N-ter/s1 22 e,23, 97 d, f
Exon 3d 134delG Deletion 1 45GfsX1 PTC N-ter/s1 98
Exon 3 163C>T Nonsense 3 R55X PTC N-ter/s1 31, 97 d, f,99
Exon 3 168delC Deletion 1 ? PTC N-ter/s1 31
Exon 3 180G>Ad Nonsense 1 W60X PTC N-ter/s1 97
Exon 3 185delAGTT Deletion 1 62KfsX34 PTC N-ter/s1 28
Exon 3 212delT Deletion 1 71LfsX26 PTC M1 100g
Intron 3 235-2A>G Acceptor splice 2     M1 101, 102
Exon 5 335delT Deletion 1 111LfsX19 PTC M2 23
Intron 5 360+1G>A Donor splice 1     M2 33
Intron 5 360+1G>C Donor splice 1   Skip exon 5 M2 24
Intron 5 360+2T>A Donor splice 2   Skip exon 5 M2 103
Intron 5 361–1G>Ad Acceptor splice 1   PTC/skip exon 6 M2 19
Intron 5d 361-2A>Gd Acceptor splice 1   PTC/loss exon 6 M2 104
Exon 6 366T>A Nonsense 1 Y122X PTC M2 105
Exon 7 457C>T Nonsense 8 R153X PTC A 7, 20, 21, 23, 24, 25 e,106
Exon 7 490delT Deletion 1 163LfsX24 PTC A 13
Exon 7 519insA Insertion 2 173LfsX3 PTC A 13, 33
Exon 7 520delC Deletion 1 174RfsX14 PTC A 24
Intron 7 531+2T>Ad Donor splice 1     A 18
Exon 8 602C>Th Missense 2 P201Lh   A 6 d,13
Exon 8d 635C>A Nonsense 1 S212X PTC A 96
Exon 8 661A>Cd Missense 1 T221P   A 87
Exon 8 681dupA Insertion 1 227KfsX13 PTC A 24
Intron 8 688-1G>A Acceptor splice 1     A 13
Exon 9 689G>A Missense 1 G230D   A 107
Exon 9 705delA Deletion 1 235TfsX12 PTC A 108
Exon 9 745C>T Nonsense 1 Q249X PTC S3 13
Exon 10 767insCCCT Insertion 1 256TfsX42 PTC S3 7
Exon 10 775C>T Nonsense 1 Q259X PTC S3 105
Exon 10 806T>G Missense 1 L269R   M3 105
Exon 10 832G>Ai Missense/insertion 2 278GfsX22   M3 91
Intron 10 832+3A>T Donor splice 2     M3 13
Intron 10 832+2T>C Donor splice 1   Skip exon 10 M3 20
Intron 10d 833-1G>Ad Acceptor splice 1     M3 6
Exon 11 836insT Insertion 1 279IfsX19 PTC M3 7
Exon 11 854G>A Nonsense 1 W285X PTC l2 95
Intron 11 899+1G>T Donor splice 1   PTC M4 24
Intron 11 899+1G>C Donor splice 2   PTC M4 109
Exon 12 910G>T Missense 2 A304S   M4 7 j,20
Exon 12 920C>T Missense 1 P307L   M4 104
Exon 12 920C>A Missense 1 P307H   M4 36
Exon 12 923delAAG Deletion 1 308delEk   M4 28
Exon 12 925G>T Missense 1 G309C   M4 13
Exon 12 932del21bpd Deletion 1 311deld   M4 18
Exon 12 935T>C Missense 1 I312T   M4 110
Exon 12 950del9bp/ins24bpl Deletion/insertion 1 318-320del/insl   S4 20
Exon 12 953T>C Missense 1 L318P   S4 7
Exon 12 956delC Deletion 1 319AfsX3 PTC S4 24
Exon 12 1001delA Deletion 1 333KfsX12 PTC S4 13
Exon 12 1004T>C Missense 1 L335P   S4 111
Exon 12 1022T>C Missense 1 L341P   S4 13
Intron 12 1024+1G>Ad Donor splice 1   PTC/skip exon 12 S4 21
Exon 13 1031G>Ad, h Missense 1 C344Yd, h   P 6
Exon 13 1042T>C Missense 1 C348R   P 105
Exon 13 1045delT Deletion 1 348CfsX6 PTC P 13
Exon 13 1049A>T Missense 3 D350V   P 28
Exon 13 1055C>Td Missense 1 T352I   P 112
Exon 13 1058G>Td Missense 1 G353V   P 30
Exon 13d 1067delC Deletion 1 356TfsX3 PTC P 96
Exon 13 1068del16bpm Deletion 1 356TfsX60 PTC P 113
Exon 13 1085insA Insertion 1 363TfsX11 PTC P 29
Exon 13 1087A>G Missense 1 T363A   P 114
Exon 13 1089delTCAC Deletion 4 363TfsX21 PTC P 13, 23, 28, 115
Exon 14 1218G>Cd Missense 1 E406D Skip exon 14 P 19
Exon 15 1231T>C Missense 1 C411R   P 13
Exon 15d 1250G>Ad Missense 3 R417K   P 32
Intron 15 1308+1G>A Donor splice 1     P 36
Intron 15 1309-1G>A Acceptor splice 1     P 13
Intron 15 1309-4a>t/1309-2a>g Acceptor splice 1   Skip exon 16 P 7
Exon 16 1327C>Td Nonsense 1 Q443Xd PTC P 6
Exon 16 1388T>G Missense 1 V463G   P 20
Exon 16 1402C>T Nonsense 4 R468X PTC P 7, 26, 27, 28
Exon 16 1413G>C Missense 1 Q471H   ? 110
Intron 16 1415-2A>C Acceptor splice 1   PTC/skip exon 17 ? 104
Exon 17 1413del28bpn Deletion 2 472DfsX14 PTC ? 116
Exon 17 1431T>A Nonsense 1 C477X PTC ? 117
Exon 17 1455delAd Deletion 1 485QfsX1 PTC N? 118
Exon 17 1462deld,o Deletion 1 488delo   N 104
Exon 17 1469G>T Missense 1 C490F   N 31
Exon 17 1508delCTCAd Deletion 1 503TfsX32 PTC N 18
Exon 17 1510C>T Nonsense 1 Q504X PTC N 36
Exon 17 1516C>T Nonsense 4 Q506X PTC N 29, 30 d
Exon 17 1523delAT Deletion 2 508DfsX23 PTC N 97, 104
Exon 17 1566delCA Deletion 1 522LfsX9 PTC N 7
Intron 17 1570+2T>C Donor splice 1   PTC N 24
Exon 18 1582G>C Missense 1 A528P   N 23
Exon 18 1588G>C Missense 1 G530R   N 95
Exon 18 1685C>G Nonsense 3 S562X PTC N 6 d,13, 28
Exon 18 1709C>Td, h Missense 2 T570Id, h   N 6
Exon 18 1723delG Deletion 1 574QfsX24 PTC N 13
Exon 18 1738A>G Missense 2 I580V   N 13, 31
Intron 18 1694-1G>A Acceptor splice 1     N 6
Exon 19 1751T>C Missense 1 L584P   N 21
Exon 19 1782delAGTC Deletion 1 593SfsX5 PTC N 119
Exon 19 1816C>T Nonsense 1 Q606X PTC N 13
Intron 19 1839+2insTd Donor splice 1   PTC N 23
Intorn 19 1840-1G>C Acceptor splice 1     N 98
Exon 20 1854G>Ad Missense 1 R619K   N 87
Exon 20 1869delG Deletion 1 623RfsX2 PTC N 33
Exon 20 1874delA Deletion 1 M626X PTC N 120
Exon 20 1875delG Deletion 1 M626X PTC s5 7
Intron 20 1890+1delGTGAG/ins Donor splice 1     s5 22 e
Intron 20 1891-1G>T Acceptor splice 1     s5 121
Exon 21 1897C>T Nonsense 1 Q633X PTC s5 122
Exon 21 1914del/insd Deletion/insertion 1 638Vfs10X PTC s5 123 d
Exon 21 1922T>G Missense 1 M641R   s5 7
Exon 21d 1931A>G Missense 1 D644G   s5 33
Exon 21 1933G>A Missense 1 G645R   s5 7
Exon 21 1934G>Td Missense 1 G645V   s5 124
Exon 21 1942G>T Missense 1 D648Y   s5 104
Exon 21 1952C>A Missense 1 A651D   s5 105
Exon 21 1982T>G Missense 1 M661R   s5 113
Exon 21 1983delG Deletion 1 661MfsX14 PTC s5 7
Exon 21 2023delAd Deletion 1 675MfsX PTC s5 18
Exon 21 2025delG Deletion 1 675MfsX2 PTC s5 105
Intron 21d 2058(-17C>T)d Acceptor splice 1   PTC s5 97
Intron 21d 2058-1G>Cd Acceptor splice 1     s5 28
Intron 21 2058-1G>A Acceptor splice 1   Skip exon 22 s5 7
Exon 22 2068G>T Nonsense 1 E690X PTC s5 110
Exon 22 2111insA Insertion 1 704RfsX23 PTC M5 20
Exon 22 2126C>T Missense 3 T709M   M5 7, 28, 107
Intron 22 2127+1G>Ad Donor splice 2   Skip exon 23 (?) M5 28 d,125 d
Intron 22d 2126(+5G>A)d Donor splice 1   PTC M5 97
Exon 23 2132T>G Missense 1 I711R   M5 31
Exon 23 2141T>A Nonsense 1 L714X PTC M5 23
Exon 23 2164insACAT Insertion 1 722LfsX6 PTC l3 122
Exon 23 2198A>G Missense 1 Q733R   M6 31
Exon 23 2215delATT Deletion 1 739delI   M6 20
Exon 23 2224G>T Missense 1 D742Y   M6 13
Exon 23 2227delGd Deletion 1 743GfsX8 PTC M6 6
Exon 23 2231C>G Missense 2 P744R   M6 7 p,20
Exon 23 2235insC Insertion 1 746AfsX10 PTC M6 107
Exon 23 2236G>Ad Missense 1 A746Td   M6 18
Exon 23 2237C>Td Missense 1 A746V   M6 34
Intron 23 2243+2T>C Donor splice 1   PTC M6 104
Exon 24 2246T>G Missense 1 L749R   M6 20
Exon 24 2251delGT Deletion 1 751VfsX5 PTC s6 126
Exon 24 2264delA Deletion 2 755DfsX17 PTC s6 25, 33
Exon 24 2303delAC Deletion 2 768DfsX4 PTC s6 7, 20
Exon 24 2339delTTGTd Deletion 1 780LfsX3 PTC M7 19
Exon 24 2357delTT Deletion 1 786IfsX10 PTC M7 7
Exon 24 2365G>A Missense 1 G789R   M7 13
Exon 24 2371delTTGT Deletion 4 791LfsX12 PTC M7 7, 20, 127 d
Exon 24 2374delTTTG Deletion 10 792FfsX10 PTC M7 6 d,7, 13, 23, 31, 117, 128, 129 d,130
Exon 24 2375delTTGT Deletion 2 792FfsX4 PTC M7 102, 104
Exon 24 2384G>A Nonsense 1 W795X PTC l4 22 e
Exon 25 2395C>T Nonsense 14 R799X PTC l4 16 d,25, 31, 32, 33, 34 d
Exon 25d 2412delT Deletion 1 803IfsX7 PTC l4 102
Exon 25 2416C>T Nonsense 1 R806X PTC l4 13
Exon 25 2422delAC Deletion 2 808TfsX10 PTC l4 33
Exon 25 2445del10bp Deletion 3 814CfsX7 PTC M8 131
Exon 25 2454delT Deletion 1 818FfsX6 PTC M8 31
Exon 25 2454dupT Insertion 1 D819X PTC M8 28
Exon 25 2460delG Deletion 1 820MfsX4 PTC M8 21
Exon 25 2468A>Cd Missense 2 A823E   M8 97
Exon 26 2529delGT Deletion 1 843MfsX27 PTC M9 7
Exon 26 2558del10bpq Deletion 1 853MfsX17 PTC M9 31
Exon 26 2593C>Td Nonsense 2 Q865Xd PTC l5 6, 112
Exon 26d 2597A>C Missense 1 K866T   l5 96
Intron 26 2630-1delG Acceptor splice 2     M10 6 d,13
Exon 27 2660C>A Nonsense 1 S887X PTC M10 22e
Appendix 1
Exon 23 2130T>Cd Polymorphism 1 S710Sd   M5 87, 88
Appendix 2
Number Mutation % PTC %
59 Deletion/insertion 35.54 55 59.78
24 Nonsense 14.46 24 26.09
49 Missense 29.52 0 0.00
34 Acceptor/donor splice 20.48 13 14.13
166     92 55.42
Appendix 3
Normal                          
p.309 G G P I V V T V T L A L p.320
c.925 GGT CTC CCC ATT GTG GTC ACA GTG ACG CTA GCT CTT c.960
c.925 GGT CTC CTA GCT CTT c.939              
p.309 G L L A L p.313              
Mutant                          

Human ATP2C1 gene mutations were summarized. The mutations are grouped for deletion/insertion (azure), nonsense (orange), missense (yellow), acceptor/donor splice (green). Nucleotides are reported in italic along the table as well as in the figure legend and along the full manuscript. We found some reported mutations were inaccurate or not unified. Therefore, we revised or collated some descriptions according to the reported cDNA reference sequence (GenBank accession No. NM_AF181120).7

Appendix 1: A polymorphism was wrongly reported to be a new mutation 2323C>T generating Y711H.87 After careful check with the correct reading frame this was not a mutation but a polymorphism.88

Appendix 2: A resuming panel graphs the amount and relative percentage of each kind of mutations and PTC.

Appendix 3: The 884–904delCCATTGTGGTCACAGTGACGC mutation and consequent amino acid 296-302delIVVTVTL was incorrectly reported,18 while it referred to as a 21bp deletion located at 932-952 and amino acid 311-317delPIVVTVT. This mutation did not generate the reported missense mutation P295V;18 the first ‘C' of the codon 311 (encoding for a proline, P) recombined with ‘TA' of codon 318 (leucine, L) generating the codon CTA which encoded for a leucine.

a

Number of reported cases of patients presenting the mutation.

b

Missense mutations causing an amino acid substitution in extremely conserved residue through all the ATPases and in different species are highlighted in light pink.23

c

Putative protein domain prediction is based on the position of the equivalent residue within the structure of ATP2A1 (SERCA1).

d

Using the running correct coding sequence and relative reading frame of the ATP2C1 gene (Ref. NG_007379.1) we unified the position of the mutation site, protein change, exon/intron location all over the reported mutations. In doing this we found few mutations published as new which were already known.

e

The same authors published their findings in two identical papers on different journals.22, 89

f

Due to incorrect interpretation of discovered mutations the authors reported as new previously reported mutations.90

g

In their manuscript, the authors reported a previously described mutation. A mistake on referring to this mutation was recently reported (see erratum in Acta Derm Venereol 2015; 95: 1040).

h

P201L, C344Y, and T570I, respectively, represent mutations P185L, C328Y, and T554I, originally reported by Sudbrak et al.6 Mutation nomenclature has now been updated with respect to the 5'-end sequence published by Hu et al7 and the results of 5' RACE-PCR experiments from Fairclough et al.36

i

The missense mutation 832G>A causing the nucleotide change G278R generated an aberrant splicing with a resulting insertion of the first 11 bp (GTAAGAGAAGA) from intron 10 between the mutated exon10 and the exon 11 (see Figure 5 in Chao et al)91 causing a PTC.

j

This mutation was incorrectly reported as A304T by Hu et al7 as previously reported.20

k

E308, and not G309 (which are both Ca2+-binding site residue), was deleted.

l

950delCGCTAGCTCTT>CT>insCCACAATGTGTTGGTGTTATGAGAAT (underlined are the deleted/inserted nucleotides) generates the in frame 318delLAL/insTMCWCYEN.

m

1068delAAGAATGAAATGACTG.

n

The delGACAGACCAGAGATTTGTTTTATGAAAG cause a frame shift and PTC.

o

In frame delAAGTACTGTACTACATACCAGAGC with amino acid delKYCTTYQS.

p

This mutation was incorrectly reported as P724R by Hu et al7 as previously reported.20

q

The deleted sequence is TGGGACAATT.