Table 1. Mutations on the ATP2C1 gene reported in the literature.
Exon/Intron | Nucleotide change | Mutation | Numbera | Codonb | Effect | Domainc | References |
---|---|---|---|---|---|---|---|
Exon 2 | 28delG/ins24bpd | Deletion/insertion | 1 | PTC | N-ter | 6, 23 d | |
Exon 2d | 115C>T | Nonsense | 4 | R39X | PTC | N-ter/s1 | 6, 18, 19 |
Intron 2 | 117+2T>G | Donor splice | 1 | PTC(?) | N-ter/s1 | 95 | |
Intron 2 | 118-2A>G | Acceptor splice | 1 | PTC | N-ter/s1 | 96 | |
Intron 2 | 118-1G>A | Acceptor splice | 3 | N-ter/s1 | 22 e,23, 97 d, f | ||
Exon 3d | 134delG | Deletion | 1 | 45GfsX1 | PTC | N-ter/s1 | 98 |
Exon 3 | 163C>T | Nonsense | 3 | R55X | PTC | N-ter/s1 | 31, 97 d, f,99 |
Exon 3 | 168delC | Deletion | 1 | ? | PTC | N-ter/s1 | 31 |
Exon 3 | 180G>Ad | Nonsense | 1 | W60X | PTC | N-ter/s1 | 97 |
Exon 3 | 185delAGTT | Deletion | 1 | 62KfsX34 | PTC | N-ter/s1 | 28 |
Exon 3 | 212delT | Deletion | 1 | 71LfsX26 | PTC | M1 | 100g |
Intron 3 | 235-2A>G | Acceptor splice | 2 | M1 | 101, 102 | ||
Exon 5 | 335delT | Deletion | 1 | 111LfsX19 | PTC | M2 | 23 |
Intron 5 | 360+1G>A | Donor splice | 1 | M2 | 33 | ||
Intron 5 | 360+1G>C | Donor splice | 1 | Skip exon 5 | M2 | 24 | |
Intron 5 | 360+2T>A | Donor splice | 2 | Skip exon 5 | M2 | 103 | |
Intron 5 | 361–1G>Ad | Acceptor splice | 1 | PTC/skip exon 6 | M2 | 19 | |
Intron 5d | 361-2A>Gd | Acceptor splice | 1 | PTC/loss exon 6 | M2 | 104 | |
Exon 6 | 366T>A | Nonsense | 1 | Y122X | PTC | M2 | 105 |
Exon 7 | 457C>T | Nonsense | 8 | R153X | PTC | A | 7, 20, 21, 23, 24, 25 e,106 |
Exon 7 | 490delT | Deletion | 1 | 163LfsX24 | PTC | A | 13 |
Exon 7 | 519insA | Insertion | 2 | 173LfsX3 | PTC | A | 13, 33 |
Exon 7 | 520delC | Deletion | 1 | 174RfsX14 | PTC | A | 24 |
Intron 7 | 531+2T>Ad | Donor splice | 1 | A | 18 | ||
Exon 8 | 602C>Th | Missense | 2 | P201Lh | A | 6 d,13 | |
Exon 8d | 635C>A | Nonsense | 1 | S212X | PTC | A | 96 |
Exon 8 | 661A>Cd | Missense | 1 | T221P | A | 87 | |
Exon 8 | 681dupA | Insertion | 1 | 227KfsX13 | PTC | A | 24 |
Intron 8 | 688-1G>A | Acceptor splice | 1 | A | 13 | ||
Exon 9 | 689G>A | Missense | 1 | G230D | A | 107 | |
Exon 9 | 705delA | Deletion | 1 | 235TfsX12 | PTC | A | 108 |
Exon 9 | 745C>T | Nonsense | 1 | Q249X | PTC | S3 | 13 |
Exon 10 | 767insCCCT | Insertion | 1 | 256TfsX42 | PTC | S3 | 7 |
Exon 10 | 775C>T | Nonsense | 1 | Q259X | PTC | S3 | 105 |
Exon 10 | 806T>G | Missense | 1 | L269R | M3 | 105 | |
Exon 10 | 832G>Ai | Missense/insertion | 2 | 278GfsX22 | M3 | 91 | |
Intron 10 | 832+3A>T | Donor splice | 2 | M3 | 13 | ||
Intron 10 | 832+2T>C | Donor splice | 1 | Skip exon 10 | M3 | 20 | |
Intron 10d | 833-1G>Ad | Acceptor splice | 1 | M3 | 6 | ||
Exon 11 | 836insT | Insertion | 1 | 279IfsX19 | PTC | M3 | 7 |
Exon 11 | 854G>A | Nonsense | 1 | W285X | PTC | l2 | 95 |
Intron 11 | 899+1G>T | Donor splice | 1 | PTC | M4 | 24 | |
Intron 11 | 899+1G>C | Donor splice | 2 | PTC | M4 | 109 | |
Exon 12 | 910G>T | Missense | 2 | A304S | M4 | 7 j,20 | |
Exon 12 | 920C>T | Missense | 1 | P307L | M4 | 104 | |
Exon 12 | 920C>A | Missense | 1 | P307H | M4 | 36 | |
Exon 12 | 923delAAG | Deletion | 1 | 308delEk | M4 | 28 | |
Exon 12 | 925G>T | Missense | 1 | G309C | M4 | 13 | |
Exon 12 | 932del21bpd | Deletion | 1 | 311deld | M4 | 18 | |
Exon 12 | 935T>C | Missense | 1 | I312T | M4 | 110 | |
Exon 12 | 950del9bp/ins24bpl | Deletion/insertion | 1 | 318-320del/insl | S4 | 20 | |
Exon 12 | 953T>C | Missense | 1 | L318P | S4 | 7 | |
Exon 12 | 956delC | Deletion | 1 | 319AfsX3 | PTC | S4 | 24 |
Exon 12 | 1001delA | Deletion | 1 | 333KfsX12 | PTC | S4 | 13 |
Exon 12 | 1004T>C | Missense | 1 | L335P | S4 | 111 | |
Exon 12 | 1022T>C | Missense | 1 | L341P | S4 | 13 | |
Intron 12 | 1024+1G>Ad | Donor splice | 1 | PTC/skip exon 12 | S4 | 21 | |
Exon 13 | 1031G>Ad, h | Missense | 1 | C344Yd, h | P | 6 | |
Exon 13 | 1042T>C | Missense | 1 | C348R | P | 105 | |
Exon 13 | 1045delT | Deletion | 1 | 348CfsX6 | PTC | P | 13 |
Exon 13 | 1049A>T | Missense | 3 | D350V | P | 28 | |
Exon 13 | 1055C>Td | Missense | 1 | T352I | P | 112 | |
Exon 13 | 1058G>Td | Missense | 1 | G353V | P | 30 | |
Exon 13d | 1067delC | Deletion | 1 | 356TfsX3 | PTC | P | 96 |
Exon 13 | 1068del16bpm | Deletion | 1 | 356TfsX60 | PTC | P | 113 |
Exon 13 | 1085insA | Insertion | 1 | 363TfsX11 | PTC | P | 29 |
Exon 13 | 1087A>G | Missense | 1 | T363A | P | 114 | |
Exon 13 | 1089delTCAC | Deletion | 4 | 363TfsX21 | PTC | P | 13, 23, 28, 115 |
Exon 14 | 1218G>Cd | Missense | 1 | E406D | Skip exon 14 | P | 19 |
Exon 15 | 1231T>C | Missense | 1 | C411R | P | 13 | |
Exon 15d | 1250G>Ad | Missense | 3 | R417K | P | 32 | |
Intron 15 | 1308+1G>A | Donor splice | 1 | P | 36 | ||
Intron 15 | 1309-1G>A | Acceptor splice | 1 | P | 13 | ||
Intron 15 | 1309-4a>t/1309-2a>g | Acceptor splice | 1 | Skip exon 16 | P | 7 | |
Exon 16 | 1327C>Td | Nonsense | 1 | Q443Xd | PTC | P | 6 |
Exon 16 | 1388T>G | Missense | 1 | V463G | P | 20 | |
Exon 16 | 1402C>T | Nonsense | 4 | R468X | PTC | P | 7, 26, 27, 28 |
Exon 16 | 1413G>C | Missense | 1 | Q471H | ? | 110 | |
Intron 16 | 1415-2A>C | Acceptor splice | 1 | PTC/skip exon 17 | ? | 104 | |
Exon 17 | 1413del28bpn | Deletion | 2 | 472DfsX14 | PTC | ? | 116 |
Exon 17 | 1431T>A | Nonsense | 1 | C477X | PTC | ? | 117 |
Exon 17 | 1455delAd | Deletion | 1 | 485QfsX1 | PTC | N? | 118 |
Exon 17 | 1462deld,o | Deletion | 1 | 488delo | N | 104 | |
Exon 17 | 1469G>T | Missense | 1 | C490F | N | 31 | |
Exon 17 | 1508delCTCAd | Deletion | 1 | 503TfsX32 | PTC | N | 18 |
Exon 17 | 1510C>T | Nonsense | 1 | Q504X | PTC | N | 36 |
Exon 17 | 1516C>T | Nonsense | 4 | Q506X | PTC | N | 29, 30 d |
Exon 17 | 1523delAT | Deletion | 2 | 508DfsX23 | PTC | N | 97, 104 |
Exon 17 | 1566delCA | Deletion | 1 | 522LfsX9 | PTC | N | 7 |
Intron 17 | 1570+2T>C | Donor splice | 1 | PTC | N | 24 | |
Exon 18 | 1582G>C | Missense | 1 | A528P | N | 23 | |
Exon 18 | 1588G>C | Missense | 1 | G530R | N | 95 | |
Exon 18 | 1685C>G | Nonsense | 3 | S562X | PTC | N | 6 d,13, 28 |
Exon 18 | 1709C>Td, h | Missense | 2 | T570Id, h | N | 6 | |
Exon 18 | 1723delG | Deletion | 1 | 574QfsX24 | PTC | N | 13 |
Exon 18 | 1738A>G | Missense | 2 | I580V | N | 13, 31 | |
Intron 18 | 1694-1G>A | Acceptor splice | 1 | N | 6 | ||
Exon 19 | 1751T>C | Missense | 1 | L584P | N | 21 | |
Exon 19 | 1782delAGTC | Deletion | 1 | 593SfsX5 | PTC | N | 119 |
Exon 19 | 1816C>T | Nonsense | 1 | Q606X | PTC | N | 13 |
Intron 19 | 1839+2insTd | Donor splice | 1 | PTC | N | 23 | |
Intorn 19 | 1840-1G>C | Acceptor splice | 1 | N | 98 | ||
Exon 20 | 1854G>Ad | Missense | 1 | R619K | N | 87 | |
Exon 20 | 1869delG | Deletion | 1 | 623RfsX2 | PTC | N | 33 |
Exon 20 | 1874delA | Deletion | 1 | M626X | PTC | N | 120 |
Exon 20 | 1875delG | Deletion | 1 | M626X | PTC | s5 | 7 |
Intron 20 | 1890+1delGTGAG/ins | Donor splice | 1 | s5 | 22 e | ||
Intron 20 | 1891-1G>T | Acceptor splice | 1 | s5 | 121 | ||
Exon 21 | 1897C>T | Nonsense | 1 | Q633X | PTC | s5 | 122 |
Exon 21 | 1914del/insd | Deletion/insertion | 1 | 638Vfs10X | PTC | s5 | 123 d |
Exon 21 | 1922T>G | Missense | 1 | M641R | s5 | 7 | |
Exon 21d | 1931A>G | Missense | 1 | D644G | s5 | 33 | |
Exon 21 | 1933G>A | Missense | 1 | G645R | s5 | 7 | |
Exon 21 | 1934G>Td | Missense | 1 | G645V | s5 | 124 | |
Exon 21 | 1942G>T | Missense | 1 | D648Y | s5 | 104 | |
Exon 21 | 1952C>A | Missense | 1 | A651D | s5 | 105 | |
Exon 21 | 1982T>G | Missense | 1 | M661R | s5 | 113 | |
Exon 21 | 1983delG | Deletion | 1 | 661MfsX14 | PTC | s5 | 7 |
Exon 21 | 2023delAd | Deletion | 1 | 675MfsX | PTC | s5 | 18 |
Exon 21 | 2025delG | Deletion | 1 | 675MfsX2 | PTC | s5 | 105 |
Intron 21d | 2058(-17C>T)d | Acceptor splice | 1 | PTC | s5 | 97 | |
Intron 21d | 2058-1G>Cd | Acceptor splice | 1 | s5 | 28 | ||
Intron 21 | 2058-1G>A | Acceptor splice | 1 | Skip exon 22 | s5 | 7 | |
Exon 22 | 2068G>T | Nonsense | 1 | E690X | PTC | s5 | 110 |
Exon 22 | 2111insA | Insertion | 1 | 704RfsX23 | PTC | M5 | 20 |
Exon 22 | 2126C>T | Missense | 3 | T709M | M5 | 7, 28, 107 | |
Intron 22 | 2127+1G>Ad | Donor splice | 2 | Skip exon 23 (?) | M5 | 28 d,125 d | |
Intron 22d | 2126(+5G>A)d | Donor splice | 1 | PTC | M5 | 97 | |
Exon 23 | 2132T>G | Missense | 1 | I711R | M5 | 31 | |
Exon 23 | 2141T>A | Nonsense | 1 | L714X | PTC | M5 | 23 |
Exon 23 | 2164insACAT | Insertion | 1 | 722LfsX6 | PTC | l3 | 122 |
Exon 23 | 2198A>G | Missense | 1 | Q733R | M6 | 31 | |
Exon 23 | 2215delATT | Deletion | 1 | 739delI | M6 | 20 | |
Exon 23 | 2224G>T | Missense | 1 | D742Y | M6 | 13 | |
Exon 23 | 2227delGd | Deletion | 1 | 743GfsX8 | PTC | M6 | 6 |
Exon 23 | 2231C>G | Missense | 2 | P744R | M6 | 7 p,20 | |
Exon 23 | 2235insC | Insertion | 1 | 746AfsX10 | PTC | M6 | 107 |
Exon 23 | 2236G>Ad | Missense | 1 | A746Td | M6 | 18 | |
Exon 23 | 2237C>Td | Missense | 1 | A746V | M6 | 34 | |
Intron 23 | 2243+2T>C | Donor splice | 1 | PTC | M6 | 104 | |
Exon 24 | 2246T>G | Missense | 1 | L749R | M6 | 20 | |
Exon 24 | 2251delGT | Deletion | 1 | 751VfsX5 | PTC | s6 | 126 |
Exon 24 | 2264delA | Deletion | 2 | 755DfsX17 | PTC | s6 | 25, 33 |
Exon 24 | 2303delAC | Deletion | 2 | 768DfsX4 | PTC | s6 | 7, 20 |
Exon 24 | 2339delTTGTd | Deletion | 1 | 780LfsX3 | PTC | M7 | 19 |
Exon 24 | 2357delTT | Deletion | 1 | 786IfsX10 | PTC | M7 | 7 |
Exon 24 | 2365G>A | Missense | 1 | G789R | M7 | 13 | |
Exon 24 | 2371delTTGT | Deletion | 4 | 791LfsX12 | PTC | M7 | 7, 20, 127 d |
Exon 24 | 2374delTTTG | Deletion | 10 | 792FfsX10 | PTC | M7 | 6 d,7, 13, 23, 31, 117, 128, 129 d,130 |
Exon 24 | 2375delTTGT | Deletion | 2 | 792FfsX4 | PTC | M7 | 102, 104 |
Exon 24 | 2384G>A | Nonsense | 1 | W795X | PTC | l4 | 22 e |
Exon 25 | 2395C>T | Nonsense | 14 | R799X | PTC | l4 | 16 d,25, 31, 32, 33, 34 d |
Exon 25d | 2412delT | Deletion | 1 | 803IfsX7 | PTC | l4 | 102 |
Exon 25 | 2416C>T | Nonsense | 1 | R806X | PTC | l4 | 13 |
Exon 25 | 2422delAC | Deletion | 2 | 808TfsX10 | PTC | l4 | 33 |
Exon 25 | 2445del10bp | Deletion | 3 | 814CfsX7 | PTC | M8 | 131 |
Exon 25 | 2454delT | Deletion | 1 | 818FfsX6 | PTC | M8 | 31 |
Exon 25 | 2454dupT | Insertion | 1 | D819X | PTC | M8 | 28 |
Exon 25 | 2460delG | Deletion | 1 | 820MfsX4 | PTC | M8 | 21 |
Exon 25 | 2468A>Cd | Missense | 2 | A823E | M8 | 97 | |
Exon 26 | 2529delGT | Deletion | 1 | 843MfsX27 | PTC | M9 | 7 |
Exon 26 | 2558del10bpq | Deletion | 1 | 853MfsX17 | PTC | M9 | 31 |
Exon 26 | 2593C>Td | Nonsense | 2 | Q865Xd | PTC | l5 | 6, 112 |
Exon 26d | 2597A>C | Missense | 1 | K866T | l5 | 96 | |
Intron 26 | 2630-1delG | Acceptor splice | 2 | M10 | 6 d,13 | ||
Exon 27 | 2660C>A | Nonsense | 1 | S887X | PTC | M10 | 22e |
Appendix 2 | ||||
---|---|---|---|---|
Number | Mutation | % | PTC | % |
59 | Deletion/insertion | 35.54 | 55 | 59.78 |
24 | Nonsense | 14.46 | 24 | 26.09 |
49 | Missense | 29.52 | 0 | 0.00 |
34 | Acceptor/donor splice | 20.48 | 13 | 14.13 |
166 | 92 | 55.42 |
Appendix 3 | |||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Normal | |||||||||||||
p.309 | G | G | P | I | V | V | T | V | T | L | A | L | p.320 |
c.925 | GGT | CTC | CCC | ATT | GTG | GTC | ACA | GTG | ACG | CTA | GCT | CTT | c.960 |
c.925 | GGT | CTC | CTA | GCT | CTT | c.939 | |||||||
p.309 | G | L | L | A | L | p.313 | |||||||
Mutant |
Human ATP2C1 gene mutations were summarized. The mutations are grouped for deletion/insertion (azure), nonsense (orange), missense (yellow), acceptor/donor splice (green). Nucleotides are reported in italic along the table as well as in the figure legend and along the full manuscript. We found some reported mutations were inaccurate or not unified. Therefore, we revised or collated some descriptions according to the reported cDNA reference sequence (GenBank accession No. NM_AF181120).7
Appendix 1: A polymorphism was wrongly reported to be a new mutation 2323C>T generating Y711H.87 After careful check with the correct reading frame this was not a mutation but a polymorphism.88
Appendix 2: A resuming panel graphs the amount and relative percentage of each kind of mutations and PTC.
Appendix 3: The 884–904delCCATTGTGGTCACAGTGACGC mutation and consequent amino acid 296-302delIVVTVTL was incorrectly reported,18 while it referred to as a 21bp deletion located at 932-952 and amino acid 311-317delPIVVTVT. This mutation did not generate the reported missense mutation P295V;18 the first ‘C' of the codon 311 (encoding for a proline, P) recombined with ‘TA' of codon 318 (leucine, L) generating the codon CTA which encoded for a leucine.
Number of reported cases of patients presenting the mutation.
Missense mutations causing an amino acid substitution in extremely conserved residue through all the ATPases and in different species are highlighted in light pink.23
Putative protein domain prediction is based on the position of the equivalent residue within the structure of ATP2A1 (SERCA1).
Using the running correct coding sequence and relative reading frame of the ATP2C1 gene (Ref. NG_007379.1) we unified the position of the mutation site, protein change, exon/intron location all over the reported mutations. In doing this we found few mutations published as new which were already known.
Due to incorrect interpretation of discovered mutations the authors reported as new previously reported mutations.90
In their manuscript, the authors reported a previously described mutation. A mistake on referring to this mutation was recently reported (see erratum in Acta Derm Venereol 2015; 95: 1040).
P201L, C344Y, and T570I, respectively, represent mutations P185L, C328Y, and T554I, originally reported by Sudbrak et al.6 Mutation nomenclature has now been updated with respect to the 5'-end sequence published by Hu et al7 and the results of 5' RACE-PCR experiments from Fairclough et al.36
The missense mutation 832G>A causing the nucleotide change G278R generated an aberrant splicing with a resulting insertion of the first 11 bp (GTAAGAGAAGA) from intron 10 between the mutated exon10 and the exon 11 (see Figure 5 in Chao et al)91 causing a PTC.
E308, and not G309 (which are both Ca2+-binding site residue), was deleted.
950delCGCTAGCTCTT>CT>insCCACAATGTGTTGGTGTTATGAGAAT (underlined are the deleted/inserted nucleotides) generates the in frame 318delLAL/insTMCWCYEN.
1068delAAGAATGAAATGACTG.
The delGACAGACCAGAGATTTGTTTTATGAAAG cause a frame shift and PTC.
In frame delAAGTACTGTACTACATACCAGAGC with amino acid delKYCTTYQS.
The deleted sequence is TGGGACAATT.