TABLE 1.
Primers used in this study
| Primer | Sequencea | Purpose |
|---|---|---|
| DMT 1 | 5′ GGCGTTTTGTTTATGTGCG 3′ | Amplification of a 559-bp fragment of tet(O) (5′ end) |
| DMT 2 | 5′ ATGGACAACCCGACAGAAGC 3′ | Amplification of a 559-bp fragment of tet(O) (3′ end) |
| CAT 5 | 5′ TATATGAATTCAATGAAAATTATTAATATTGGAG 3′ | Amplification of tet(M) |
| CAT 6 | 5′ TATATGGATCCACTAAGTTATTTTATTGAAC 3′ | Amplification of tet(M) |
| tetA F | 5′ TTCTCTATATCGGGCGGATCGTGGC 3′ | Amplification of ∼700-bp fragment of tet(A) gene |
| tetA R | 5′ CCACCCGAAGCAAGCAGGACCATG 3′ | Amplification of ∼700-bp fragment of tet(A) gene |
| tetB F | 5′ CCTTATCATGCCAGTCTTGCCAACG 3′ | Amplification of ∼900-bp fragment of tet(B) gene |
| tetB R | 5′ CCTGTAAAGCACCTTGCTGATGACTC 3′ | Amplification of ∼900-bp fragment of tet(B) gene |
| tetE F | 5′ CTGGTCAGATCGCATAGGTCGTCG 3′ | Amplification of ∼1-kb fragment of tet(E) gene |
| tetE R | 5′ CCATACCCATCCATTCCACGTTTCGC 3′ | Amplification of ∼1-kb fragment of tet(E) gene |
| aphA-3 F | 5′ GGGACCACCTATGATGTGGAACG 3′ | Amplification of 600 bp of aphA-3 gene |
| aphA-3 R | 5′ CAGGCTTGATCCCCAGTAAGTC 3′ | Amplification of 600 bp of aphA-3 gene |
| DOB 3 | 5′ TATATGAATTCAATGAAAATAATTAACTTAGGCATTC 3′ | Cloning of tet(O) into pMS119EH (5′ end) |
| SEAN 20 | 5′ TATATGGATCCTTAAGCTAACTTGTGGAACATATGCC 3′ | Cloning of tet(O) into pMS119EH (3′ end) |
| DMT 27 | 5′ GGCATTCTGGCTCACGTTGACGC 3′ | Sequencing of tet(O) |
| SEAN 5 | 5′ ACTGCTCCGTCTAATACG 3′ | Sequencing of tet(O) |
| SEAN 6 | 5′ CAGAACTGGAACAGGAAG 3′ | Sequencing of tet(O) |
| SEAN 9 | 5′ ATGCACCGCAGGAATATC 3′ | Sequencing of tet(O) |
| DMT 29 | 5′ GTGAAGCAAAAGGTTGGGCAGC 3′ | Sequencing of tet(O) |
| DMT 30 | 5′ GCAGACTTTCGGCTGCTTTC 3′ | Sequencing of tet(O) |
| DMT 50 | 5′ CTGCGGCAACAGTATTTCG 3′ | Sequencing of tet(O) |
| DMT 20 | 5′ TATAAGCGCTGGATGAGGAGGCAGATTGCC 3′ | Cloning of aphA-3 kanamycin resistance cassette into tet(O) |
| DMT 21 | 5′ TATAAGCGCTCTAAAACAATTCATCCAG 3′ | Cloning of aphA-3 kanamycin resistance cassette into tet(O) |
| DMT 22 | 5′ TATAGGATCCAATGAAAATAATTAACTTAGGCATTC 3′ | Cloning of tet(O) ORF into pRY107 (5′ end) |
| DMT 23 | 5′ TATAGGATCCCTGTCAATTTGATAGTGGGAAC 3′ | Cloning of tet(O) ORF and its P1 promoter into pRY107 (5′ end) |
| DMT 24 | 5′ TATAGGATCCGCATAAACAGATGATTAGTGG 3′ | Cloning of tet(O) ORF and its P1/P2 promoters into pRY107 (5′ end) |
| DMT 25 | 5′ TATAGGATCCGATATCCACTTGGCTTTATC 3′ | Cloning of tet(O) ORF and a ∼1000-bp upstream region into pRY107 (5′ end) |
| DMT 26 | 5′ TATAGAATTCTTAAGCTAACTTGTGGAACATATGCC 3′ | Cloning of tet(O) into pRY107 (3′ end) |
| 16S F1 | 5′ TAAGTGATCGATTGAGCCAGAAAC 3′ | Cloning of 16S rRNA genes of C. jejuni |
| 16S R1 | 5′ GCTAATTCCCCATAAACAATTAGC 3′ | Cloning of 16S rRNA genes of C. jejuni |
| T7 (F) | 5′ GTAATACGACTCACTATAGGGC 3′ | Sequencing of 16S rRNA genes of C. jejuni for vector |
| 16S F2 | 5′ ACACGGTCCAGACTCCTA 3′ | Sequencing of 16S rRNA genes of C. jejuni |
| 16S F3 | 5′ GATTAGATACCCTGGTAGTC 3′ | Sequencing of 16S rRNA genes of C. jejuni |
| 16S F4 | 5′ AGTCCCGCAACGAGCGCAA 3′ | Sequencing of 16S rRNA genes of C. jejuni |
| r3L | 5′ TTGCGCTCGTTGCGGGACT 3′ | Sequencing of 16S rRNA genes of C. jejuni for vector |
| T3 (R) | 5′ AATTAACCCTCACTAAAGGG 3′ | Sequencing of 16S rRNA genes of C. jejuni |
a
Restriction enzyme sites are underlined.