Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
List of the primer sequences used for the quantitative PCR.
| Gene | Forward primer sequence | Reverse primer sequence |
|---|---|---|
| Orai 1 | cctggcgcaagctctactta | catcgctaccatggcgaagc |
| Orai 2 | gtgggtctcatcttcgtggt | tcttcgatctcacggttgtg |
| Orai 3 | tgcactgatggtctccacat | tgcactgatggtctccacat |
| STIM 1 | ttgggcctcctctcttgact | gccacccacaccaataacga |
| STIM 2 | aatcagcgaccgaagtcaca | ttatgaggtgggcgtgtcag |
| TRPC 1 | aagcttttcttgctggcgtg | ctcccaagcacatctacgca |
