TABLE 1.
Strains, plasmids, and oligonucleotides used in this study
| Strain, plasmid, or oligonucleotide | Characteristic(s)a | Source or reference |
|---|---|---|
| Strains | ||
| E. coli DH5α | F recA1 hsdR17 thi-1 gyrA96 supE44 endA1 relA1 recA1 deoR Δ(lacZYA-argF)U169 (φ80 lacZΔM15) | |
| M. smegmatis | ||
| mc2155 | Parental strain | 24 |
| Ami37 | Mutant in mca | This study |
| Ami40 | Mutant in mca | This study |
| ami37phint | Ami37 complemented with M. smegmatis mca | This study |
| ami37palace | Ami37 complemented with M. tuberculosis mca | This study |
| Plasmids | ||
| pMR1082K | Knockout construct with M. smegmatis mca disrupted with gentamicin resistance cassette | This study |
| pALACE | Hygr | 17 |
| pHINT | Hygr | K. Downing |
| pGINT | Genr | K. Downing |
| pCR2.1 | TA cloning vector, Ampr Kanr | Invitrogen |
| pMK1082 | PCR-amplified M. smegmatis mca cloned into pCR 2.1 | This study |
| pHINTmk1082 | M. smegmatis mca cloned into pHINT | This study |
| pMR4 | M. tuberculosis mca cloned into pALACE vector | 22 |
| Oligonucleotides | ||
| Pgint1082i-5′ | TTAAGCTTGCCGAAGCGCTGATACG | This study |
| Pgint1082i-3′ | TTGATATCGGCTCGTCGGCCAGAAG | This study |
a
Ampr, ampicillin resistance; Kanr, kanamycin resistance; Genr, gentamicin resistance; Hgr, hygromycin resistance.