Figure 1.

Sequencing of MDM2 SNPs 285 and 309. Sequencing of MDM2 SNP 285 was performed as described in Spiegelberg et al.²⁶ using PCR sense primer 5′-TGGACTGGGGCTAGGCAGTC-3′ and antisense primer 5′CTGAGTCAACCTGCCCACTG3′ at a 62.9 °C annealing temperature. The PCR product size was 248 bp and also encompassed the neighboring MDM2 SNP309 region. The sequencing result is shown for an RCC sample. Sequencing of SNP285 showed a G/G homozygous (sense strand) and, correspondingly, a C/C homozygous (antisense strand) genotype. Sequencing of SNP309 revealed a T/T homozygous (sense strand) and, accordingly, an A/A homozygous (antisense strand) genotype.