TABLE 1.
Oligonucleotide use and name | Sequence (5′ to 3′) |
---|---|
Amplification | |
abcZ-fN1 | gttttcccagtcacgacgttgta CCGGTTTGCAAAAGCTCGACGAC |
abcZ-rN2 | ttgtgagcggataacaatttc TTGTCAAAGAGGCGGTTGTGTTCC |
adk-fN1 | gttttcccagtcacgacgttgtaGCACTCAGGCGCAATTCATCACC |
adk-rN2 | ttgtgagcggataacaatttc TTTGCCCAATGCGCCCAATACTTC |
aroE-fN1 | gttttcccagtcacgacgttgtaCTGGCGGACGAGCATTCCGAACGC |
aroE-rN2 | ttgtgagcggataacaatttc GCGGTAATCCAGTGCGACATCGCG |
fumC-fN1 | gttttcccagtcacgacgttgtaCGTCTGAACGATGCGCTTAAAGAC |
fumC-rN2 | ttgtgagcggataacaatttcTCGGCAGGAACGACCAGTTCGTC |
gdh-fN1 | gttttcccagtcacgacgttgtaGAAGGGCAAATTTACCGCATCGAC |
gdh-rN2 | ttgtgagcggataacaatttcCCAAATCGGTTGCCAGCGGCACGG |
pdhC-fN1 | gttttcccagtcacgacgttgtaTGCCGGCCGTACGACGCTGAACGG |
pdhC-rN2 | ttgtgagcggataacaatttcGCGTTTCCAGCTAGGAGCTGAATC |
pgm-fN1 | gttttcccagtcacgacgttgtaCCTGCAAGATTTGATTGCCGCGCT |
pgm-rN2 | ttgtgagcggataacaatttcACGCATCAGACCGAAGCCGTCGGG |
Sequencing | |
Universal forward | gttttcccagtcacgacgttgta |
Universal reverse | ttgtgagcggataacaatttc |
The sequences of upstream and downstream oligonucleotides (for amplification) of each gene (series N1 and N2, respectively) are given as uppercase letters. Universal forward and reverse oligonucleotides were added as adaptors in front of each oligonucleotide and are given as lowercase letters. Universal forward and reverse oligonucleotides were used for sequencing.