FIG. 2.

H. pylori infection of primary-cell preparations and NCI-N87 cells induces increased levels of annexin II and S100 A7 protein expression. Ten microliters of H. pylori with an OD₆₀₀ of 0.5 was used to inoculate 1 ml of growth medium. The infected epithelial cells were maintained in 10% CO₂ at 37°C for 48 h prior to collection of protein. (A) Whole-cell lysates were prepared from control and infected-primary-cell preparations, and protein was analyzed by SDS-PAGE using 7.5% polyacrylamide gels. Annexin II protein expression was analyzed by blotting with a monoclonal anti-annexin II antibody. Annexin IV protein was analyzed by blotting with a monoclonal anti-annexin IV antibody. The density of the bands was related to that of the housekeeping protein histone 2B. Cnt, control uninfected cells; +H.p, H. pylori-infected cells. (B) Semiquantitative RT-PCR, using ribosomal 18S as the internal standard, confirmed that S100 A7 transcripts were upregulated in H. pylori-infected primary cells. The PCRs were carried out with 2 μl of cDNA in a 25-μl total volume of PCR buffer. S100 A7 primers had the following sequences: forward, 5′GAAAGCAAAGATGAGCAACACTC3′; reverse, 5′TTGGTGGGGCTGGGTCACTG3′. The PCR products were electrophoresed in a 1.2% agarose gel. The DNA was visualized and photographed with the Eagle Eye II video system (Stratagene). The ratio of the band intensity for SSTR-1 to that for the internal standard for the uninfected sample was compared with the corresponding ratio for the infected samples. (C) Total RNA (25 ng) was extracted from NCI-N87 cells. The RNA was then electrophoresed in a denatured 1% formaldehyde agarose gel and transferred to a nylon membrane. The membrane was then hybridized with a ³²P-labeled probe against S100 A7 and GAPDH. After 2 h the filter was washed and autoradiographed with Kodak XAR5 film for 16 h at −70°C. GAPDH was used as the internal standard and confirmed that S100 A7 levels were upregulated in H. pylori-infected NCI-N87 cells. Data are representative of six independent experiments.