Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers for validation of the TCA pathway mutants
| Purpose | Primer name | Forward primer (5′ to 3′) | Reverse primer (5′ to 3′) |
| Segregation check of fumarate hydratase mutant | Synpcc 1007 F/R | AACATCAAATCCAGTCGGCG | TCATTTGCCCATTACTCGCG |
| Segregation check of malic enzyme | Synpcc 1297 F/R | CATTAAGACTCTTCGCAC | GAAACAATATCTGCCCTAC |
| Segregation check of succinate dehydrogenase subunit B | Synpcc 1533 F/R | TTTTGGGTACGGCCTATT | CTCTAGAACAACTGAATCC |
