Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Sequences of qRT-PCR primers for target genes.
| Genes | Forward | Reverse |
|---|---|---|
| GAPDH | cggatttggtcgtattggg | ctcgctcctggaagatgg |
| SART1 | gaaccttgtggcttctcttca | gtcatccactgcccattagg |
| MxA | acctgatggcctatcaccag | tgaagaactggatgatcaaagg |
| OAS | gacggatgttagcctgctg | tggggatttggtttggtg |
| PKR | aaagcgaacaaggagtaag | gatgatgccatcccgtag |
