FIG. 1.

129SvEv (A) and Stat1^−/− (B) mice were infected with SARS CoV, and tissues were harvested, homogenized, and analyzed for levels of SARS CoV by using a limiting-dilution plaque assay (i.e., PFU) on Vero E6 cells and for levels of SARS CoV genomes by using TaqMan RT-PCR. Stat1^−/− mice were initially generated by Meraz et al. (8) by mating the original chimera directly to a 129SvEv mouse to produce 129SvEv heterozygotes which were intercrossed to obtain the desired homozygotes on a pure 129SvEv background. The animals were purchased from Taconic Animal Models. The Toronto-2 strain of SARS CoV was initially isolated in Canada from a human patient with a fatal case of SARS; the stock used for infection was a third passage recovered from supernatants of infected Vero E6 cells (titer = 1.2 × 10⁸ PFU/ml). One microgram of total-tissue RNA was reverse transcribed using the high-capacity cDNA archive kit (Applied Biosystems, Foster City, Calif.) by following the manufacturer's instructions. Crude SARS CoV RNA that was extracted from infected Vero E6 cells served as a control in each RT-PCR run. For the real-time PCRs, primer and probe sets were designed to target the N gene of the SARS CoV. The restriction fragment of the N gene isolated from a plasmid construct was serially diluted and used as a template to establish the standard curves. One-tenth of each RT reaction mixture was used in TaqMan PCRs, which were carried out on an ABI PRISM 7700 sequence detector (Applied Biosystems). Each data point represents the result from a separate animal. Recovery of virus is presented as numbers of PFU per lung and is represented by blue triangles, and viral genome levels are presented as numbers of copies per microgram of total RNA for lungs, livers, and spleens. Animals were harvested at the indicated times. (C and D) Analysis of total cellular RNA for the presence of the subgenomic mRNA encoding nucleoprotein. The strategy was to amplify RNA by PCR using probes specific to the leader and nucleoprotein sequences. If the nascent RNA was processed into a subgenomic transcript, the PCR should yield a band of approximately 350 bp in length (C). One microgram of each total-tissue RNA was diluted in water in a final volume of 50 μl, and the RNA was reverse transcribed using the high-capacity cDNA archive kit (Applied Biosystems) in a 100-μl reaction mixture. RNAsecure (Ambion, Austin, Tex.) was added to the RT reaction mixtures to ensure the inactivation of RNase in solutions. The RT reaction was carried out in the GeneAmp PCR System 9600 thermal cycler in two incubation steps, an initial 25°C incubation for 10 min followed by a final 37°C incubation for 2 h. A no-reverse transcriptase control was included in the RT reactions. For the PCR step, two primers were designed to target the common leader sequence region (PCR-L, 5′ GGAAAAGCCAACCAACCTCGATCTC 3′) and the body sequence (PCR-N, 5′ TCGGGTAGCTCTTCGGT AGTAGCC 3′) of the N gene open reading frame. The N gene-specific sequence in the PCR amplicon is 280 bp in length. Since there is no published sequence for the transcript between the leader sequence and the start codon of subgenomic mRNA for the N gene, we estimated that the entire amplicon should be 300 to 400 bp by using the two primers described above. (D) An aliquot of each RT reaction mixture (5 μl) from 11 samples (input virus control, input virus control without reverse transcriptase, three day-3 lung samples from three 129SvEv [129] mice, day-22 lung and spleen samples from one 129SvEv mouse each, a day-3 lung sample from one Stat1^−/− [stat1] mouse, and day-22 lung, liver, and spleen samples from one Stat1^−/− mouse) was subjected to PCR in 25-μl reaction mixtures under the standard PCR conditions. Ten microliters each of PCR products was electrophoresed on a 1.2% agarose gel and visualized by ethidium bromide staining. TRS, transcription regulatory sequence; Seq-N, SARS virus N gene sequence; PI, postinoculation.