Table 2.
FISH probes used. Probes were labelled on the 5′ end using either 6-FAM or Tamra. The table also indicates where on the LSU rDNA fragment these probes bind and for which sequence-types they are specific.
Probe | Probe sequence | Dye | (KX011135) Isolate e3, Germany | AB526843 Isolate NGY, Japan |
---|---|---|---|---|
Pl_LSU_3690 | GCGGCAGTGATTTTCGGTTT | 6-FAM | bp 3675 | bp 3684 |
Pl_LSU_2313 | CCAGGCCTTTCAGCCAAGTA | 6-FAM | bp 2313 | bp 2317 |
Pl_LSU_5721 | CAGCGTCACCCAACCCTTAG | 6-FAM | bp 5711 | N |
J_LSU_5721 | TCCATCCGCTCAACCCTTAG | Tamra | N | bp 5723 |
Pl_LSU_6826 | ATTCCAGAAGTCTGCCGCTC | 6-FAM | bp 6819 | N |
J_LSU_6826 | AGTCTAGAAACAAAGGCCTC | Tamra | N | bp 6336 |