Skip to main content
. 2016 Dec 29;100(1):75–90. doi: 10.1016/j.ajhg.2016.12.003

Table 5.

High-Impact, Likely Biallelic Variants in 19 Genes in Unsolved Cases

Individual Phenotype Sex Ethnicity Gene Variant genomic Variant HGVSc Variant HGVSp GT Consequence Description
G001284 multiple F SAS SCAPER 15:76998312G>A ENST00000563290.1; c.2179C>T p.Arg727Ter 0/1 stop_gained S-phase cyclin A-associated protein in the ER
G001284 multiple F SAS SCAPER 15:77064214CA>C ENST00000563290.1; c.1116delT p.Val373SerfsTer21 0/1 frameshift S-phase cyclin A-associated protein in the ER
G001298 RD F SAS FUT5 19:5867071G>T ENST00000252675.5; c.666C>A p.Tyr222Ter 1/1 stop_gained fucosyltransferase 5 (alpha (1,3) fucosyltransferase)
G001298 RD F SAS PODNL1 19:14046820C>CAGCT ENST00000339560.5; c.374_377dupAGCT p.Gln127AlafsTer119 1/1 frameshift podocan-like protein 1-like
G001411 RP M AFR NAALADL1 11:64812774G>GC ENST00000358658.3; c.2191dupG p.Ala731GlyfsTer9 0/1 frameshift N-acetylated alpha-linked acidic dipeptidase-like 1
G001411 RP M AFR NAALADL1 11:64822078G>A ENST00000358658.3; c.736C>T p.Arg246Ter 0/1 stop_gained N-acetylated alpha-linked acidic dipeptidase-like 1
G005002 CRD M SAS WASF3 13:27216381GTGTTTTCAATTTTCAGATTGTGAACCA>G ENST00000335327.5; c.−10-14_3delTTTTCAATTTTCAGATTGTGAACCATG NA 1/1 splice_acceptor WAS protein family, member 3
G005019 Usher F SAS PLD4 14:105395186GC>G ENST00000392593.4; c.388delC p.Gln130ArgfsTer108 0/1 frameshift phospholipase D family, member 4
G005019 Usher F SAS PLD4 14:105398102CTGTCCCCA>C ENST00000392593.4; c.937_944delTGTCCCCA p.Cys313GlyfsTer167 0/1 frameshift phospholipase D family, member 4
G005203 RP F SAS FAM71A 1:212799206T>TGCAG ENST00000294829.3; c.991_994dupGGCA p.Thr332ArgfsTer88 1/1 frameshift family with sequence similarity 71, member A
G005251 cone dystrophy M SAS POMZP3 7:76240807T>TG ENST00000310842.4; c.538dupC p.Gln180ProfsTer14 1/1 frameshift POM121 and ZP3 fusion
G005492 RP F EUR IRX5 16:54967694CTAAAG>C ENST00000394636.4; c.1362_1366delTAAAG p.Lys455ProfsTer19 1/1 frameshift iroquois homeobox 5
G005513 Stargardt M EUR ITIH2 10:7776934CT>C ENST00000358415.4; c.1838delT p.Leu613ArgfsTer5 0/1 frameshift inter-alpha-trypsin inhibitor heavy chain 2
G005513 Stargardt M EUR ITIH2 10:7780709CAT>C ENST00000358415.4; c.2084_2085delAT p.His695ArgfsTer5 0/1 frameshift inter-alpha-trypsin inhibitor heavy chain 2
G005514 RP M AFR SLC37A3 7:140064249G>A ENST00000326232.9; c.334C>T p.Arg112Ter 1/1 stop_gained solute carrier family 37, member 3
G007696 CRD M SAS NUMB 14:73746066G>GC ENST00000355058.3; c.1162dupG p.Ala388GlyfsTer6 1/1 frameshift numb homolog (Drosophila)
G007696 CRD M SAS FAM57B 16:30038139GC>G ENST00000380495.4; c.234delG p.Gln79AsnfsTer43 1/1 frameshift family with sequence similarity 57, member B
G007723 RP M SAS FOXI2 10:129536034AC>A ENST00000388920.4; c.498delC p.Asp166GlufsTer87 1/1 frameshift forkhead box I2
G008152 RP M EUR CROCC 1:17292217G>A ENST00000375541.5; c.4406−1G>A NA 1/1 splice_acceptor ciliary rootlet coiled-coil, rootletin
W000146 RP F EUR CCZ1B 7:6844600C>A ENST00000316731.8; c.1075G>T
ENST00000375541.5; c.4406−1G>A
p.Glu359Ter 1/1 stop_gained CCZ1 vacuolar protein trafficking and biogenesis associated homolog B (S. cerevisiae)
W000278 other F SAS OR2M7 1:248487484AG>A ENST00000317965.2; c.386delC p.Pro129LeufsTer2 1/1 frameshift olfactory receptor, family 2, subfamily M, member 7
W000375 RP M SAS PRTFDC1 10:25231367T>C ENST00000320152.6; c.49−2A>G NA 1/1 splice_acceptor phosphoribosyl transferase domain containing 1
W000375 RP M SAS UBAP1L 15:65395024T>G ENST00000559089.1; c.121−2A>C NA 1/1 splice_acceptor ubiquitin associated protein 1-like

Genomic coordinates refer to genome build GRCh37. Analysis is limited to cases that underwent WGS in whom pathogenic variants in known genes were not detected and whose family history is not inconsistent with recessive inheritance of disease. Abbreviations: RP, retinitis pigmentosa; RD, retinal dystrophy; CRD, cone-rod dystrophy; other, any phenotype with frequency of fewer than eight individuals; multiple, more than one phenotype including syndromic cases.