TABLE 2 .
Primers used in this study
| Primer | Primer sequence (5′ −3′) | Purpose | Reference |
|---|---|---|---|
| hfq-Mut_F | AAGAATTGATCAGGCCTGTC | Deletion of the hfq gene | This study |
| hfq-Mut_R | CCGACGATGCGTAAATTGGA | Deletion of the hfq gene | This study |
| apra_F | TTCATGTGCAGCTCCATCAGC | Deletion of the hfq gene | This study |
| apra_R | GAGCGGATCGGGGATTGTCTT | Deletion of the hfq gene | This study |
| hfq-apra_R | GCTGATGGAGCTGCACATGAATGCAATTTAATACCATTGACCAGG | Deletion of the hfq gene | This study |
| hfq-apra_F | GAGCGGATCGGGGATTGTCTTTCTGGTGAGGAAGAAGGAACTG | Deletion of the hfq gene | This study |
| hfqanti-hfq1_F | ACACTCCAAAACGAGGCGGCTG | Deletion of the hfq and anti-hfq genes | This study |
| hfqanti-hfq2_R | GCTGATGGAGCTGCACATGAACGGGTATCTAACTATTTATTCGA | Deletion of the hfq and anti-hfq genes | This study |
| hfqanti-hfq2_F | GAGCGGATCGGGGATTGTCTTACTGTGGCAGACTAATCAATTTA | Deletion of the hfq and anti-hfq genes | This study |
| hfqanti-hfq1_R | CGACATCCAAATAATCGCTCG | Deletion of the hfq and anti-hfq genes | This study |
| Hfq_comple_F | AAGCTTGCCAGTCTCAATGCAATTGCG | Complementation of hfq and hfqanti-hfq | This study |
| Hfq_comple_R | GTCGACTTGATTAGTCTGCCACAGTTCC | Complementation of hfq and hfqanti-hfq | This study |
| M-10anti-hfq_F | ATTGACCAGGAACACTGAAACCGGGACCTTTTCCTTGCGCAATTCATT | Mutation of the −10 promoter of anti-hfq | This study |
| M-10anti-hfq_R | AATGAATTGCGCAAGGAAAAGGTCCCGGTTTCAGTGTTCCTGGTCAAT | Mutation of the −10 promoter of anti-hfq | This study |
| anti-hfq_OE_F | TCTAGAGCGCAATTCATTTAGGAAAGG | Overexpression of anti-hfq | This study |
| anti-hfq_OE_R | CTGCAGAAACCACGCTGTCATGAAAATATAC | Overexpression of anti-hfq | This study |
| anti-hfq_3′ RACE_F | TTTAGGAAAGGGTCTTGTAGTAAATG | 3′ RACE anti-hfq | This study |
| anti-hfq_3′ RACE_R | AATAGTTAGATACCCGTTTTTGCC | 3′ RACE anti-hfq | This study |
| rnaseIII_Mut_F | ATGCGCTCAGCAATTGAATTAGC | Deletion of the RNase III gene | This study |
| rnaseIII_Mut_R | TCTGGTCTGGATGAGTTGGAATG | Deletion of the RNase III gene | This study |
| rnaseIII_Inv_F | GAGCGGATCGGGGATTGTCTTTATCGCTACCAGCACTGCAATG | Deletion of the RNase III gene | This study |
| rnaseIII_Inv_R | GCTGATGGAGCTGCACATGAATGTAACATGCACAATTGAGGGAG | Deletion of the RNase III gene | This study |
| anti-hfq RNA_T7_F | TAATACGACTCACTATAGGCGCAATTCATTTAGGAAAGGG | In vitro transcription of anti-hfq | This study |
| anti-hfq RNA_T7_R | T AGTTAGATACCCGTTTTTGCC | In vitro transcription of anti-hfq | This study |
| hfqmRNA_T7_F | TAATACGACTCACTATAGGGATAGGGTGTCGAATAAATAG | In vitro transcription of hfq mRNA | This study |
| hfqmRNA_T7_R | TTGATTAGTCTGCCACAGTTCC | In vitro transcription of hfq mRNA | This study |
| lpp0644 _T7_F | TAATACGACTCACTATAGGGGAATGTTATGAGTGACTTG | In vitro transcription of lpp0644 | This study |
| lpp0644_T7_R | TCCAGTCGTCTGCGCGCATCC | In vitro transcription of lpp0644 | This study |
| hfqOUT_T7_F | TAATACGACTCACTATAGGGTCAATGGTATTAAATTGCATGGG | In vitro transcription of hfq mRNA missing the 5′ UTR | This study |
| anti-hfq_qPCR_F | TTTAGGAAAGGGTCTTGTAGTAA | qPCR analysis of the anti-hfq region overlapping hfq mRNA | This study |
| anti-hfq_qPCR_R | AATAGTTAGATACCCGTTTTTGCC | qPCR analysis of the anti-hfq region overlapping hfq mRNA | This study |
| tldD_qPCR_F | AATCGGAACGTCGATGATGCTG | qPCR analysis of the tldD mRNA | This study |
| tldD_qPCR_R | ATCCCTACCCCCTTATCCAGAG | qPCR analysis of the tldD mRNA | This study |
| gyrB_qPCR_F | GAGCGTAGACGCCAGTTATGA | qPCR analysis of the gyrB mRNA | This study |
| gyrB_qPCR_R | TGATGCAAACCGGTTCCATCA | qPCR analysis of the gyrB mRNA | This study |
| hfqmRNA_NB_F | TAATACGACTCACTATAGGGAACAACTGTTGAAATGGCGTG | Northern blot analysis of hfq mRNA | This study |
| hfqmRNA_NB_R | GTTTCAGTGTTCCTGGTCAATGG | Northern blot analysis of hfq mRNA | This study |
| hfq_qPCR_F | TCAGTGTTCCTGGTCAATGG | Determination of hfq mRNA half-life | This study |
| hfq_qPCR_R | AACAACTGTTGAAATGGCGTG | Determination of hfq mRNA half-life | This study |
| gapdH_qPCR_F | TTGATACGACAGTGGTCTATGG | Determination of GAPDH mRNA half-life | This study |
| gapdH_qPCR_R | CATGGACAGTGTTGACTAAGCC | Determination of GAPDH RNA half-life | This study |
| 16S_qPCR_F | TTGTCTAGCTTGCTAGACAGATGG | Determination of 16S half-life | This study |
| 16S_qPCR_R | AGCTTTCGTCCTCAGACATTATGC | Determination of 16S half-life | This study |