Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
LAP and ubiquitin primers used for real-time PCR and PCR results
| Genea | Primer sequence (5′→3′) | Position in coding sequence | PCR product length (bp) | EMBL accession no.a |
|---|---|---|---|---|
| LAP forward | GAAATTCTCAAAGCTGCCGTA | 100 | 114 | S76279 |
| LAP reverse | TCCTCCTGCAGCATTTTACTT | 193 | ||
| Ubiquitin forward | GGCAAGACCATCACCCTGGAA | 798 | 201 | Z18245 |
| Ubiquitin reverse | GCCACCCCTCAGACGAAGGA | 998 |
GenBank accession number of the published bovine nucleic acid sequence.
